Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1308
Length(NT) : 781
Best Gene Model Blast : Link to GSTUMT00000949001 E-value : 1e-112
Numbers of ESTs : 3

Blast Results:

Nr Definition: response regulator-like protein
Accession: dbj|BAE93903.1| Score: 298 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: ang:An06g01690 Score: 292 E_value: 5e-25
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0627 Score: 241 E_value: 2e-21
PFAM Definition: HSF_DNA-bind, HSF-type DNA-binding..
Pfam Number: pfam00447 Score: 268 E_value: 2e-24
Swissprot: O14283|PRR1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0000156 = Molecular function: two-component response regulator activity
GO:0000747 = Biological process: conjugation with cellular fusion
GO:0006355 = Biological process: regulation of transcription, DNA-dependent
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig1308
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGACACTATTCCAATACTCGAACCCCAACCAATTCTCTGAGC
TTTCAAAAGAAACTTCCGCGTTGTGAACCACCCCGCTCTATACTGGAGAC
GGTTACAGCAGAGGTTCAGCACGTCCGCCACGGAACAGTGCCATCTACTA
TTATAGTCAGCAACTTCTTTACAGGCATCAGGAGTTCTCTGTGCTCTCGG
GACTTTCCCTTGCGGCTCTACTACCCATTTTTCCCTCCCGTGTCGGCCTT
CTTCCATTTCGCACCTCAACACCTCAACACTTCAGCGCCCCAGACTGCTC
TGCCTGTCTGGGGTATTCTCGGATTCACTGTGTTTTGGATACTGGGTGTT
GGGGCGAAATATAGGCCTGGATGGAGGGAAATGTCTCTGGTGGGGGTGGT
GCTGGTGGTGGCCCGGCTTCGAGCAGTAGTAGCGACTTTGTATGTTGCCT
CATGGTGTCTGTGTTCCTGGAGGCGAGCTCTAATGGTTATTTCGTTATGC
GTTCTCTAGGTCCGAAAACTCTATAAAATGTTGGAAGACCCTACGCATCG
GCAGACGGTTCGATGGAGCGATGCTGGTGATAGTTTTATAGTTGTAGATA
CCAACGAGTTCACCAGAAACATACTACCGAATCATTTCAAGCACAGCAAT
TTTGCGAGTTTTGTCAGACAGCTAAATAAGTATGATTTTCACAAGATTCG
GAGCAATGAGGAAAGTGGAGGCAATTCTTAT

Sequences in the Contig:

SY0AAA2YE08FM1 SY0AAA47YB19FM1 SY0AAB14YF18FM1