Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1307
Length(NT) : 594
Best Gene Model Blast : Link to GSTUMT00011977001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG07069.1
Accession: ref|XP_387245.1| Score: 240 E_value: 6e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG07069.1 Score: 240 E_value: 3e-19
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0876 Score: 159 E_value: 5e-12
PFAM Definition: No Hit Found
Swissprot: P47141|RT26_YEAST
Gene Ontology:
GO:0005763 = Cellular component: mitochondrial small ribosomal subunit
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006412 = Biological process: translation

Sequence:
>Contig1307
TCCCGAGAATCGTGGGAAGATAAAATAAAATCTATCATACAATCCACCAA
CCTTCAAAAGTTGATGATCCATTGGGGTTCTTGCGGCTACAATCCGGTTA
ACCCTTGACCAACCCCCCCATCTCTTTGTTCAGGGCCACTTCCTCTTTCA
CATCTTCAACATTGCATTCAACCAGCATCCCACTATGTCGGTCCCTTTGA
CATTACGGCGGCAGGCCCTGCGAGCCTTTCCCCCATTGACCAGGAAACCG
CCAACCCTCCACAAACCTCGTTCTGTTCACTCAATGCCAGTCATTTCCTT
AACGGAAAAAGGGGTCCCGGGACTCTTCTCAGAAAAGGCGTTCAAGACAG
CATGGACAGATTACCAGAAGCATCTGGTGGAAAAACTCGGCAGTGTCACA
GCAGGCAGGGAGTTCGATGGAATGGACACAATGGATATTGCTATCGCGAC
AGCCCGACAACCAGATCAGGCCTCAATCTTTAATTATGCATCACAAGCCT
ATAACAATCATTTCTTCTTCCAGAGCTTACGCAGTGATCAAGAAGAGATA
ACCGCCCAATTCAAAGCCTACGTAATCTCCACCTTCGTTAGCGT

Sequences in the Contig:

SY0AAA47YB15FM1 SY0AAD43YD10FM1