Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1306
Length(NT) : 774
Best Gene Model Blast : Link to GSTUMT00011665001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_04219
Accession: ref|XP_001244778.1| Score: 313 E_value: 4e-27
KEGG Definition: hypothetical protein
Accession: ncr:NCU06846.1 Score: 311 E_value: 3e-27
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 432 E_value: 2e-43
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 421 E_value: 3e-42
Swissprot: P87110|ITR2_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1306
TTGGCAAACGACCTTTTGCTCATATCACACCAAACAAGCTGTAGCTCAAC
AGCCATGCCCACCGGCTATAGAAGCATCCCAGCGGAGGACGGCACATACG
AGGAAGATGAAGAGCGCCTCACCATCCTTCCATCTTCCACCGAGCCACTT
ATCAGAGACGATGGCGACAACGGGAAGAAGGGTCCCGAAGATGGTGACGA
GGTCGGACCCTGGATCTGGCTACTCACCGTGAGTGCCGGTATCAGCGGGC
TTTTGTTTGGATACGATACTGCATCTATTTCCGCTGCGCTCCTTCATCTG
GCGCCATCATTATCTACCCCAGAACATGCAGTTACAACGTGGGATAAGTC
ACTCATTACCTCGTCGACTTCTCTCGGAGCTCTAATCGGCGGATTATTTG
CCGGTTTGCTGGCGGATTACATGGGGCGTAAAGGCGTCATCTACGTCGCC
GACGCGCTATTCGTTGCGGGAGCCGCTTGGCAAGCTCTCTCGAACAGTGT
CACTACAATGGTTCTTGGCCGGATTATTGTGGGATTAGGCGTTGGCGTGG
GAAGCCTAATCGTCCCGCTTTACATCTCGGAATTATCACCTCCATCGCAC
CGTGGGAGACTCGTCATTGTAAACGTGTTATTCATTACATTCGGACAGCT
GATTGCCTATGGGTTGGGCATCATCCTGTCCCCACCCGCACTTTCTCAGG
ATGCCAGTTGGAGGTATATGCTCGGGCTTGGGGGGCTGCCAGCAGGCTTA
CAAGCCATCATAATGATATTCATG

Sequences in the Contig:

SY0AAA47YB08FM1 SY0AAD56YL24FM1