Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1305
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00006393001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: ARD/ARD family protein
Accession: ref|XP_747635.1| Score: 657 E_value: 4e-67
KEGG Definition: ARD/ARD family protein, putative
Accession: afm:AFUA_6G04430 Score: 657 E_value: 2e-67
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2107 Score: 504 E_value: 6e-52
PFAM Definition: ARD, ARD/ARD' family. The two acireductone dioxygenase enzymes (ARD and ARD', previously known as E-2 and E-2') from Klebsiella pneumoniae share the same amino acid sequence, but bind different metal ions: ARD binds Ni2+, ARD' binds Fe2+. ARD and ARD' can be experimentally interconverted by removal of the bound metal ion and reconstitution with the appropriate metal ion. The two enzymes share the same substrate, 1,2-dihydroxy-3-keto-5-(methylthio)pentene, but yield different products. ARD' yields the alpha-keto precursor of methionine (and formate), thus forming part of the ubiquitous methionine salvage pathway that converts 5'-methylthioadenosine (MTA) to methionine. This pathway is responsible for the tight control of the concentration of MTA, which is a powerful inhibitor of polyamine biosynthesis and transmethylation reactions. ARD yields methylthiopropanoate, carbon monoxide and formate, and thus prevents the conversion of MTA to methionine. The role of the ARD catalysed reaction is unclear: methylthiopropanoate is cytotoxic, and carbon monoxide can activate guanylyl cyclase, leading to increased intracellular cGMP levels. This family also contains other members, whose functions are not well characterised..
Pfam Number: pfam03079 Score: 425 E_value: 9e-43
Swissprot: O94286|MTND_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1305
TTGGGAGGACGTGCGAAGCCCCCCCTCGCAAAACCTTGCCTTTCCCCTCT
TCTCAACCCCCACCTCATCCATTCCCGGTATCTGTCCTACAGCCAACATA
AAGCGCTTGCAAAACTTCACCCCCAACCAATCCTACCATGAAGGTCTACG
AATACGATAATAGCACGGAGGATCAACGCGAGGACCACGACTCGGGAGCC
GTCGTTTCCGAAGCCGCCCTCAATGAGATCGGTGTGTTGGCTTACCATTT
CGACTCCGTTGATGACGTGAACGCTCTTGCTGCTGAGCGTGGCTATAAGA
ACCGTGATGAGGTCACAATATCCCCGAGCGCTTTAGGTGATATCTACGAA
GACAAAGTGAAGGCCTTTTTCCACGAGCACCTACACGAGGATGAGGAAAT
AAGATATATCCTAGACGGCGAGGGCTTTTTCGATGTTCGATCCAAAGATG
ACAGTTGGGTGAGGATCAGGTTGTCCAAAGGTGATTTGATTATCCTCCCA
GCAGGAATCTACCACAGGTTCACCACCGATAAAAATAACTATATCAAAGC
GATGCGACTATTCCAGGAGGATCCCAAATGGACTCCCTTGAACCGAGATC
CTCTGGTCGACGAGAATGCGTACCGAAAGGCGTATATCAACTCTCTTCCC
TTAGC

Sequences in the Contig:

SY0AAA47YB04FM1 SY0AAB49YK13FM1