Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1304
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00011125001 E-value : 1e-136
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1304
TTGGCCTCTTTCTCTTGTCCCTCGCAACTCCTCCTACAGCACTTCACTCA
AACCCACCAACAATCCCCTACACGGTCCACACCTCCCATGTTGGCAGCCT
AGCTTCTTAACTCTCAGTTATCTTGCGACCTATTTAGCATCCCCTTCCCT
CTCGTCCCCCCCCCCTTCCCTCTCCCCCTCTATCGCCCTAGTAAACGAAC
CCTCCTCCAGTCTCGAAAATACTATCCACACCCATGTCCGTCTTCCCGGT
TCGCCCACGCCCTCCCGACTCGAACTCCTCATAAAAAAGATATCGTGTCC
GAACAACAAACACACAATTAAACAGCGAAAGACTCATTCAGCTCACATGG
CAGACACAGCTACCGCCATATTCGATTTCTCCGCTGTCATAGCTCTCAAT
GATGCCCTGGCTACGAATCAAAACAGCAACCCTCTAGTCATCAATCCCGA
AAAAATTAGCGGGACTACTCCTCACCGATCCCTTGGTGACTTTACCCCCC
TCTGGGATTTTCTAGGGTCCTCGCCTGTGCCATGCACTACCACTGACGAG
GACGACCCATCACCCCCCACCCAAATTCATCCATCGCCA

Sequences in the Contig:

SY0AAA47YB02FM1 SY0AAC5YE17FM1 SY0AAD46YI23FM1