Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1302
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00001147001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001269146.1| Score: 265 E_value: 1e-21
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G11200 Score: 231 E_value: 4e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1302
TTGGATCGAATCTACACACCTCACCAGTAACCGAAAAAAGACCTACGAAA
AACGACCACCAACTACCGACGATTATCAAAAAGAAGAAAAATGCCCTCAA
GAGTGCTAATATCCCTCTCGGCCCTTCTCCTAATCCACTCCTGCTACTCC
GCGCACGAACACTCCCTTCTAATGCCAACTACCTCGCTACCGCTGGACGT
GGCGGTCGAGATGTTGGTCTCAGTGGTTCTGCTGTGCTTCGGCATCGTGC
TAGGAAATCGTGAGGAGTTGAAGCCCATCTCCTGGAGCGTGTGGAGCGGG
TTGCTGGAGCGGGAGAAGGGGTATGGACAGTTCAGCTATCTGGAGGAGCG
TGTGGGCTTTCTGGATATTAGGGCCAAGCGGGCCGAGTTTGCCAAGTGGG
TTAAGGGTGCAGAGGAAGGTTCTTCCCCTTAAAACACCTAGTGGGTCGAA
TGGATTGGATTGGACCAGATAGGTGGGTTAATTGAGGTTAATAGATGGAT
GGATTATGGATGTCATGTTCCTTCTGTAGATACGATATGGGCGTCGGAGA
TCTCCTAAAGTGGTCACAATCAAGCTGGTAATCAAGCTGGTAGAATCTGC
GCGCAAGTGTTTGCAATAGATATCATCTCGGTGTCACAAGC

Sequences in the Contig:

SY0AAA47YA04FM1 SY0AAB32YE07FM1 SY0AAB42YH02FM1
SY0AAB54YP09FM1 SY0AAC32YE07FM1 SY0AAC32YE07RM1