Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1301
Length(NT) : 761
Best Gene Model Blast : Link to GSTUMT00005791001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein PGUG_03020
Accession: ref|XP_001485291.1| Score: 215 E_value: 9e-16
KEGG Definition: CaO19.3986; hypothetical protein
Accession: cal:CaO19_3986 Score: 212 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 136 E_value: 3e-09
Swissprot: P49413|UAY_EMENI

Sequence:
>Contig1301
TTGGGAAACCCTAGGCTGTTCACAATTACTGTACATTACTCTTGCTGGGA
TGATATATACTGTAGCCTGTGTACTACACTCACCAGCCGCTAAACTCGCG
ATAAGCTGTTCCCGAACTTTCAAAATAACGGTGAAAAGGACTTCCCGTGG
TTGTTATCTTTCCCCGATTCTTCCTCTTCCTCCTCCTCCTTTCTTACCAA
TCTACACCTCCCTTCCCTCCCCTCCCCACCAATACTTCCCAAGGGATAGA
GATAACTCTCCTTTCAAGACCCACTCACTGGTACAGCACACGCTCATCCT
CAACCCGTCATCGTTAGACAACCGCGGGTGAATAGTAAACAAGCTCCGGT
CGCGCCTCCCCCTTCCCACCTTGTTTCATTTAAACAATGAAAACGAAACC
TCCATCTCCAACTTCCACCCCCGGGACCCTTCCCAAGAAATCCCGACCGT
CAACTTCACCCACAAGCGGTAGCAGCATACCTTCACCCACTACTCATCGC
CCAACCTTCAACGCTCCATCGCCCTCTGCATCCTCATCCACAGCCTCACC
GCGACGACGAAGTTCGGGTGGACAGATTTCGCGCTCCATCTCTGCCTGTA
ACCGCTGCCGCTCTCGTAAAACTAAATGTGATCAATTATTCCCGAATTGC
TCATCGTGTGCCAAAGCTGGCGTGGAATGTGTGGGGATCGACGCGGCGAC
GGGAAGGGAGGTGCCCAGGAGTTATGTGGACTGGTTGGAGAAGCGAGTGA
GGTTCCTGGAG

Sequences in the Contig:

SY0AAA42YA19FM1 SY0AAA46YP19FM1