Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1300
Length(NT) : 753
Best Gene Model Blast : Link to GSTUMT00008965001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: IBR finger domain protein
Accession: ref|XP_749767.1| Score: 456 E_value: 1e-43
KEGG Definition: IBR finger domain protein
Accession: afm:AFUA_1G00150 Score: 456 E_value: 5e-44
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1812 Score: 307 E_value: 4e-29
PFAM Definition: No Hit Found
Swissprot: Q9Z1K6|ARI2_MOUSE
Gene Ontology:
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig1300
CCGCGTCAGATCACACAAGCGAGGTTAGCGAGATTGCGGTGAATGAATGG
CAAGCAAGATTGATGCTAGAGGATCAGACGGGGGTAAGGGGCCGGTGGTT
TTAATTCCGTTACCGTGGCCTATGGCATCGGCCCTCCAGTCAATATGTTG
CTAAGATGTGATACAGGTCACACCCGGCCCATCCTGGATGCCCACTAGGA
GGGAGCCGCAGAGGGGGTGCGAAATATGCTTTGACACGTTTTCCGTCAAT
CTCACCCTGAGTGCTCCGTGCGGGCACATATACTGCCAATCCTGTATGAA
AGAAGTCTTTCTCAACGCATGTGTCGACGAGATGCTCTTCCCACCGCGGT
GTTGCAAGAGGGAGATTCCATTTCACATGGCGGAAAAGGTACTTTCGGGC
AAAGAAGTGTCGGAGTTCCGGTCGAAATCCCGCGAATATTCTAGCAAAGA
CCGGACATATTGTTGCAGACCAACTTGCTCCGAGTTTATTCCCTCAGATT
GGATCCGGGGTGACGTAGGGACTTGTCCGAAGTGTTTCGCAGTAACATGT
GCGATGTGTAAGAAGGAGCAACACCCCGGGGATTGTCCCCAAGACAAGAG
TTTGGACCTTACCTTGGAGCTTGCTGCAAGGAGCGGGTGGCAGAGATGCA
AAAATTGCCATGCGTTGGTTGAGATATCATCTGGCTGTCATCACATGACT
TGCAGGTGCAGCGCGGAATGGTGCTATAATTGCGGTGTCACCTGGAAGGA
GTG

Sequences in the Contig:

SY0AAA21YA22FM1 SY0AAA46YP08FM1 SY0AAA60YK12FM1