Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig13
Length(NT) : 1843
Best Gene Model Blast : Link to GSTUMT00001447001 E-value : 0.0
Numbers of ESTs : 64

Blast Results:

Nr Definition: fructose-bisphosphate aldolase
Accession: ref|XP_001556818.1| Score: 1536 E_value: 1e-168
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG02770.1 Score: 1525 E_value: 1e-167
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4153 Score: 1449 E_value: 1e-161
PFAM Definition: F_bP_aldolase, Fructose-bisphosphate aldolase class-II..
Pfam Number: pfam01116 Score: 836 E_value: 7e-90
Swissprot: Q9HGY9|ALF_ASPOR

Sequence:
>Contig13
TTGGCTATTCTTCCCCAGTCAACACCCTTAGCCTTAAGATTTTCCTCCAT
CTACCACTTAAACTTAAATCAAACTTATCTCTTATCGATCAGTCAGCCAG
TCAGTCAACATGGGTGTTCTCGATGTCCTTTCTAGAAAGTCTGGCGTCAT
TGTTGGCGATGACGTTTTGAACCTTTTTAAATACGCCAAGGAACACAAGT
TTGCTATTCCTGCTATCAATGTTACCTCTTCTTCAACTGTTGTTGCTTCT
CTTGAAGCAGCTAGGGACGCAAAGTCTCCTTTGATTTTGCAAATGTCCCA
GGGAGGTGCTGCCTATTTCGCTGGAAAGGGTGTCTCGAATACCGATCAGT
TTGCGTCTATCTCTGGTGCAATTGCCGGTGCCAATTACATCCGCTCAATT
GCCCCTGCCTACGGCATTCCGGTCGTCCTTCACACCGACCACTGCGCCAA
GAAGCTCTTGCCCTGGTTGGACGGCATGCTCGATGCCGATGAAAAGCACT
TTGCCGAGCATGGAGAGCCTCTCTTCTCCTCCCACATGATTGACTTGTCT
GAGGAGGACAAGGAATGGAACATTTCTACTACTAAGAAATACCTGCAACG
TGCCGCTCCCATGAGCCAGTGGCTCGAGATGGAAATTGGTATCACGGGAG
GTGAAGAGGACGGTGTTGACAACACTGGTGTCGACAACAGCTCCCTTTAC
ACCCAACCCGAAGATATCTATCAGGTCTACGAAGCTCTTTCCTCTGTCTC
TCCTTACTTTTCTATCGCTGCGGCTTTCGGAAATGTCCACGGTGTGTATA
AGCCCGGAAACGTTAAATTGCACCCCGAGCTCCTCGGAAAGCATCAAGCC
TATGCCAAAGAGAAGATCAACTGCGAGGAGGACAAACCCCTCTTCCTGGT
CTTCCATGGAGGGTCTGGTAGCAGCAAGGAGGAGTTTAGTGCTGGCATCT
CACATGGCGTTGTTAAGGTTAACTTGGACACTGATCTCCAATATGCATAT
TTGACCGGTATCCGTGATTACGTCCTCAACAAGAAGGACTTTATCGCGTC
TCAAGTCGGAAATCCTGAGGGTGAAGACAAGCCAAACAAGAAGTACTTTG
ATCCCCGTGTCTGGGTCCGTGAGGGTGAAAAGACCATGAGCGCCCGTGTC
AAGGAAGCTCTCACCGATTTTAATACTGCCAACCAATTGTAAGGAGCCGG
TCGGCGTTGATGTCATCCTCAAACGAGAAAAAAAAAGGTGGGATGGGGGG
ACGAGGCTACGACCCTCCCTGTAGTTATTAGTTTCTTTTCACAGAATCTT
AGGAGAGATTTTCTACAATAATTGGGGGATCAATACAATGTTGGGATGAC
AATATTAACTGTTCTAATCGGGTGATTTCAGGATGGGGTTCTTGCGATTC
CACGAGATGACTCTAGGAAATTTCTTAAGCACTGTGGGCTGGTTACCTAA
CCCTGTTTCTCTGAAGGCATAAACCTTTATTTGATAAAATGCGAAGCTAC
TACTAACACATGGACTATCATTTGATGCCAATAGTGTGTGATCTGATAAA
CTGAAAATACAGATACCGAGACTATTTCTGCAGCCTTGAAGAACAAAACA
ATTAGAGCGAGTGGTCTAAAAAAGGAAACCCAAGACCTGGCGATGTACTT
TCCGACTACAAGAACCAAGATTATAATAAACTAAATCTTTCCCAAAAACC
TAATAACCCTCCCAATCATGTCCGCCAGCACGTTAGCATCCACCCCCTCA
AAATTATGATTAGCCCCATTAATAACCCCACTCTCAACTTTATCCACGAC
AGCACCACCCAAAGCGCAGGCCAAGTACCACCGCTTGAGTAGG

Sequences in the Contig:

SY0AAA10YG03FM1 SY0AAA10YN01FM1 SY0AAA14YH10FM1
SY0AAA18YC10RM1 SY0AAA33YH15FM1 SY0AAA42YJ06FM1
SY0AAA43YM06FM1 SY0AAA61YJ06FM1 SY0AAA8YI01FM1
SY0AAB20YK17FM1 SY0AAB22YA15FM1 SY0AAB22YG01FM1
SY0AAB36YL02FM1 SY0AAB44YC09FM1 SY0AAB51YP08FM1
SY0AAB53YB02FM1 SY0AAB53YN05FM1 SY0AAB55YG16FM1
SY0AAB6YD18FM1 SY0AAC19YN03FM1 SY0AAC1YI19FM1
SY0AAC25YC06FM1 SY0AAC25YC06RM1 SY0AAC30YA04FM1
SY0AAC33YP01FM1 SY0AAC34YB20FM1 SY0AAC35YP12FM1
SY0AAC36YG21FM1 SY0AAC38YD05FM1 SY0AAC40YB21FM1
SY0AAC42YF02FM1 SY0AAC45YL09FM1 SY0AAC49YL20FM1
SY0AAC49YP14FM1 SY0AAC50YC05FM1 SY0AAC50YL05FM1
SY0AAC54YN04FM1 SY0AAC58YB05FM1 SY0AAC62YG12FM1
SY0AAC8YC16FM1 SY0AAD14YD23FM1 SY0AAD14YJ24FM1
SY0AAD14YN08FM1 SY0AAD17YA23FM1 SY0AAD18YF16FM1
SY0AAD20YO12FM1 SY0AAD21YL24FM1 SY0AAD27YP01FM1
SY0AAD2YE23FM1 SY0AAD30YA05FM1 SY0AAD30YD05FM1
SY0AAD32YK18FM1 SY0AAD32YL04FM1 SY0AAD35YL19FM1
SY0AAD39YK18FM1 SY0AAD44YE16FM1 SY0AAD52YD02FM1
SY0AAD55YA15FM1 SY0AAD55YF11FM1 SY0AAD57YI23FM1
SY0AAD58YC21FM1 SY0AAD59YC09FM1 SY0AAD61YP14FM1
SY0AAD63YF17FM1