Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1299
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00008114001 E-value : 8e-83
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1299
TTGGCAACGGCATCAAGGGAACGGGATTGAGCCCTCCAAGTACCATAACT
TAAGATCCCATACGAGTACCGGTAACTCACCGCCTCACCCGCCCCTTGGG
GATAATTCATTCTGGAAGATATCCACATCAGGCTGGTGCGATCTACGGCA
AGGGTACTCTGCATACCCGGAGCACTCGATGAAGAAATGGAAAAAGGCTC
GCCGCAACGCCAATGCTGAGTTGTCAGCCGCGTGTCTGTCGTGGCAGACT
GGACGTGGACATTGTGTTGTTTTTTGCTATCATACTATGATAAAGCCTTG
GTTGATTGGGAACTTGGAACTTGGGATGGAAGCGGGTATCATATGTTCAC
CACGCGTATCGTGGATTCCGAGTATATGAGCCGTCAGCCCAAATTTGAAA
ATCCTTCCCAACTCTTTTTCGCGTCGGTACTTGATGAGGGAATGGGATGA
GGTCCATGATCGAATTTGGGATATTCACGCTGTGGGCATGGGGGTGCATT
GTGTGCGCCGGCAAGGTGCCGGTAACGTATCATTCGGCACGCTGCAGTCC
TGACACGACAGAGGAGGAAGAAGGATGGCCGATTTTCCCTCAACCAATAC
CATCTCGTGCCAGTGCAG

Sequences in the Contig:

SY0AAA46YO10FM1 SY0AAC33YH09FM1 SY0AAD44YB24FM1
SY0AAD46YN13FM1