Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1298
Length(NT) : 708
Best Gene Model Blast : Link to GSTUMT00004743001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: protein MMF1, mitochondrial precursor
Accession: ref|XP_001209231.1| Score: 395 E_value: 1e-36
KEGG Definition: L-PSP endoribonuclease family protein (Hmf1), putative
Accession: afm:AFUA_7G02340 Score: 383 E_value: 1e-35
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2317 Score: 339 E_value: 9e-33
PFAM Definition: Ribonuc_L-PSP, Endoribonuclease L-PSP. Endoribonuclease active on single-stranded mRNA. Inhibits protein synthesis by cleavage of mRNA. Previously thought to inhibit protein synthesis initiation. This protein may also be involved in the regulation of purine biosynthesis..
Pfam Number: pfam01042 Score: 352 E_value: 3e-34
Swissprot: P40185|MMF1_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0009097 = Biological process: isoleucine biosynthetic process
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig1298
TTGGACTTTCGTCATCCCCTCCCTCTGTCCAAATTTACTGATAACTCGAT
GTCCCTTAAAAACTGATTGATGCCCCCTACATTTCCCTCATTTGTCCTCT
CGCATCAATTTTCGAAATACTTCATTATTAGAAGCTTGGTCACCAGAAAA
ATGAGCGCCATTCCTAAACCAGTTCTCACTCATGATGCCGCACCCCCTGC
GGGGCCCTATTCCCAAGCCATCAAGGCCAATGGTCTCATCTTCGTCTCCG
GTCAGATCCCCGCCGACAAGAGCGGCAATGTTATCAGGGGTAGCATCGAG
GAATGCACTGAGGCCGTTTTCGTGAATCTTGCTTCCGTTCTCAAGGCAGC
CAACTCCTCCTTCAACAAGGTCCTTAAAACCACCGTCTTCCTTTCAGATA
TGGCCAACTTTGCCCGCATGAATTCTGTTTATGAGAAGCATTTTTCCGGC
CACAAGCCGGCGAGGAGCTGTGTTGCTGTGAGAGAATTGCCAAAGGGAGT
TGATGTCGAGATTGAACTCGTCGCCTTGGAGGATACCCTTCCTGGGAAGG
CTCAAGAGGGGAGCCGTGGAGGCGTGGAGGAGGAGTAGATTTGAGGGTTT
TTTTCTGTGGTCAAGTGTGAGAAATTCTGTTAGAAGGGTTTTCCATGGTT
GGATCACCGCCGTCGCTCCTCTCTTTTCACCATTCGAGCCTTGGGCAAAG
TGAGCTAG

Sequences in the Contig:

SY0AAA13YG23FM1 SY0AAA46YN07FM1 SY0AAB8YN06FM1
SY0AAD28YF14FM1