Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1297
Length(NT) : 958
Best Gene Model Blast : Link to GSTUMT00004024001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: CDC42 rho GTPase-activating protein
Accession: gb|EDR12533.1| Score: 189 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: yli:YALI0B19052g Score: 182 E_value: 4e-12
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG4406 Score: 218 E_value: 1e-18
PFAM Definition: RhoGAP, RhoGAP domain. GTPase activator proteins towards Rho/Rac/Cdc42-like small GTPases..
Pfam Number: pfam00620 Score: 245 E_value: 1e-21
Swissprot: Q9P3B1|YIL2_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>Contig1297
TTGGGGCAAACCATATCGACATTACCCAACTTCACATCCCTCCGGCGGTG
TACCTACATGATCGAAAGCTTGCCGCAACAATCTCAATTCCGGACCCCCC
CCCTCCAATATTTGGGTGCCCACCCTTCCATACCGCTGCCAACCCACCAC
GAGTTGGCGAAAACATGCCACTTCCACAAGTCTTGGTAGATACTGCGCGT
TATTTGAGATCACAGTGCTTATGTGTGGAAGGACTTTTCCGAGTGACTCC
GTCCCAGGCCCTGCTCGATGTCGTCCGGGAAGCGTATGACCGCAGGCAAT
ATATCAAATGGGATGAGTGGGGTCCACATATGGCAGCAGCTTTAGTTAAG
CTATATTACCGCTCCCTTCCAGAGCCTCTTGTCCCGGTGAGGTTCTACCA
GGATTTGATATCATTCGAAGAGGCGGGGCTTGGTGATGAAAAGGCATTCC
TGAAGGTGAAGGATCTGCTAGAGGATGGCTTACCCAAGAGCAGTAGAGTC
CTTCTATTGCGGCATCTATTGCCTTTGCTCGCGCTGGTTGCACAGAATTC
GGCGGTAAACAAGTGGCTTGAGGACTTTTATCCAAATAGCTATCGAGAGG
ATCGAAGAGCTGGCGCCGGAGCTGCCAAATAGGGGCGGCCCGGTACGTCG
TAGCAGCGGGAGCAGCTCAAGCTTGATCGAGGTGCCGCCGCCCTCGGGGT
CTCCCCCACCGTATTCGATGGGTAGTATGCAGCCTGTTCAGAGGAAAAGG
CTTCCGGGTATCATGGGCACGAAGGAAATGGAGGGCGGAATGACCGCTCG
GAAACCGGTCTCCGGCAGTGCTTCTAGTTCGGTCACACATCTCCCCCCAA
CTAGCGAACCGGATGAGAGGCAATTGATTGAACCCGAAGAGCAAAGGGAA
GATACAAAACGCTCTCCCACTCCAGGACTCTCGGCCGATGAGGAACTCCC
CCGGAGGG

Sequences in the Contig:

SY0AAA46YM14FM1 SY0AAC45YJ20FM1