Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1296
Length(NT) : 788
Best Gene Model Blast : Link to GSTUMT00007354001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001552593.1| Score: 879 E_value: 9e-93
KEGG Definition: hypothetical protein [EC:3.6.3.16]; K01551 arsenite-transporting ATPase
Accession: ani:AN2909.2 Score: 858 E_value: 1e-90
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2825 Score: 860 E_value: 4e-93
PFAM Definition: ArsA_ATPase, Anion-transporting ATPase. This Pfam family represents a conserved domain, which is sometimes repeated, in an anion-transporting ATPase. The ATPase is involved in the removal of arsenate, antimonite, and arsenate from the cell..
Pfam Number: pfam02374 Score: 687 E_value: 5e-73
Swissprot: Q9P7F8|GET3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006875 = Biological process: cellular metal ion homeostasis

Sequence:
>Contig1296
TTGGAGCCTAGCTACCATATCGACACCTCGAAAAAAAAAAAACCCCTTTC
TCCCCCACACAGCTCATATTTTAAGATGTCTTCTGTCTTTGTCGATTCGG
ATCTCGACCCGCTCGAACCCACCCTCCAATCCATTCTCGACCAGAAGAGT
TTACGATGGATTTTCGTCGGCGGGAAGGGTGGAGTCGGAAAGACCACCAC
CTCTTGCTCCCTGGCTATCCAGCTTGCCAAGGTCCGTGACAGCGTTCTGC
TGATATCTACGGATCCCGCACACAATCTGAGCGATGCCTTTAACCAGAAG
TTTGGCAAGGAGGCGAGGAAGATTGAGGGGTTTGAGAACCTGAGTGCTAT
GGAGATTGATCCGAACGGTAGCATACAGGAGCTGATCGAAGGAGCCGAGG
GCTCGCAAAACCCATTGGGGAACATGATGCAGGATCTCGCATTTTCCATC
CCTGGAGTAGACGAAGCTATGTCCTTTGCCGAAGTTTTGAAGCAGGTCAA
GTCCCTTTCGTACTCGACCATCGTTTTCGATACCGCTCCTACTGGCCATA
CCCTGCGTTTCCTCCAGTTCCCCGCGGTACTGGAGAAGGCTCTCTCAAAG
ATCTCTCAACTGAGCGGGAAATTCGGCCCAATGCTTAACGGTATCCTAGG
AGCTCAGGGTGGGCCAGGCGGTGTCGATGAGATGATGCAGAAAATGGAGG
GTATGAGAGAGGTTATTGGTGAAGTTTCCAAGCAGTTCAAGGACCCTGAC
CTTACTACCTTCATTTGTGTTTGCATTCCCGAGTTCCT

Sequences in the Contig:

SY0AAA32YL16FM1 SY0AAA46YM01FM1 SY0AAA48YO21FM1
SY0AAA50YO17FM1 SY0AAA9YJ10FM1 SY0AAB21YA17FM1
SY0AAB39YK04FM1 SY0AAC7YP05FM1 SY0AAD10YB16FM1
SY0AAD27YM15FM1 SY0AAD29YF11FM1 SY0AAD43YI14FM1
SY0AAD45YB05FM1 SY0AAD60YN23FM1 SY0AAD61YM21FM1