Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1295
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00005865001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: predicted protein
Accession: aor:AO090012000627 Score: 127 E_value: 5e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1295
TTGGCCCACAGTATCATGACACACTTCTCTTCAGTCTTTCCCAACCCCAG
ACCGTTTATGAAATATGGAGATAAAGGGGAGGAAGGAAAGGAGGGATATC
CGTTTATAATTCCGGATTTGTGGAAACCTTCATGTTTTGCTCCAGATGAC
TCTGCTCAACCCACCTTGTTTCCTATTGCCCCACTACAAGAAACCGTCCT
GAATATTACTAAACCTTTAGATCCCTACAAAGATGAATCGGAAGTAAACC
TCTTCACCTTCGACCATGACTTCGCAGAGTACTTCGCCGACCCTGATCCT
GGATCCCCAACGGAGGTAGATTCCATCGCTTCAACAGCTGGAGAAGCTGT
AGAACAGGAATCCTCCGATACTAGTGAGGATATATGGCTTCGGCCTGGAT
CTTCTGATCTTCCGGTGAATCCACGGTTTCAAACATGGGAATCTTTTCTC
TCCGCCGGAGCAAACAACCCTGCCAATCCTTACCTCTCGGAGGCTGGATC
TCAAGTTTTTGATGCGGTTCTTACAGAGTACGTGGATGGGTCTGAGGAGA
TCACGGAGGTTGTGCGCACGGATGTCCTCTGCACTGTTAGTAGTAAAGAT
ATGAGTAGCTTTTAGAACTGAGGAAAACTTATACATACTTGCTAT

Sequences in the Contig:

SY0AAA46YL21FM1 SY0AAA55YM04FM1 SY0AAC57YH01FM1