Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1294
Length(NT) : 465
Best Gene Model Blast : Link to GSTUMT00010029001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein HCAG_01154
Accession: ref|XP_001544108.1| Score: 548 E_value: 7e-55
KEGG Definition: AP-1 adaptor complex subunit sigma, putative
Accession: afm:AFUA_2G01570 Score: 543 E_value: 1e-54
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0934 Score: 456 E_value: 1e-46
PFAM Definition: Clat_adaptor_s, Clathrin adaptor complex small chain..
Pfam Number: pfam01217 Score: 417 E_value: 3e-42
Swissprot: Q9P7N2|AP1S1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>Contig1294
TTGGCACAACCCTCAGTTCCAAAGACAAATCCAAGACCATAAAAGACGTA
ATACAACTCGTCCTATCCCGACGCACAAAAATGTGTAATTTCCTCGAATA
TAAAGACACAAAAGTAGTATACCGCCGCTATGCCTCCCTCTTCTTCGTTG
CGGGGATCGACAGCTCGGACAACGAACTCATCACGCTAGAAATCGTGCAC
CGCTACGTCGAACAGATGGATAAGTACTATGGAAATGTGTGCGAGCTGGA
TATCATATTTAATTTTCAGAAGGCCTATTATATCCTTGATGAGTTGTTGA
TTGCTGGCGAGATGCAGGAGAGTAGTAAGAGGGGGCTATTGAAGTATATT
GCACAGCAGGATGCGATCGAGGATACCGAGGGGGAGGAGGATAATATTTC
TAGGATAATAGGGTGAAATGAGTGAATAGGAAATGAAGGGTTTTCTTTTA
TCTTATATCAATTCA

Sequences in the Contig:

SY0AAA18YD19RM1 SY0AAA46YK24FM1