Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1293
Length(NT) : 1456
Best Gene Model Blast : Link to GSTUMT00004768001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_09604
Accession: ref|XP_001589882.1| Score: 677 E_value: 6e-69
KEGG Definition: RPA190; alpha subunit of RNA polymerase I [EC:2.7.7.6]; K02999 DNA-directed RNA polymerase I subunit A1
Accession: pic:PICST_73507 Score: 639 E_value: 8e-65
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0262 Score: 902 E_value: 1e-97
PFAM Definition: RNA_pol_Rpb1_5, RNA polymerase Rpb1, domain 5. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain, domain 5, represents the discontinuous cleft domain that is required to from the central cleft or channel where the DNA is bound..
Pfam Number: pfam04998 Score: 278 E_value: 2e-25
Swissprot: P15398|RPA1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006406 = Biological process: mRNA export from nucleus
GO:0007000 = Biological process: nucleolus organization and biogenesis

Sequence:
>Contig1293
TTGGGCCAAACGGTGTAGTAAACTGCTGCTATCCGAGGTCATTGATAACA
TCTCAATAATAGAAAACCTAACAAAAACCTCCAAGGAGTACCTTCTCCGA
CTAGAATTATTCCCGGCTTCAGATTACGAGGAGGAATACTCCATCACCAA
GCGCCAAGTTCTCAACATTCTCAAAAAGGTCTTCCTCGCTCAACTCGAGC
GCGCAATCAACAAGGTCTTAAACCCCAAGAAAGCAAAGAGCAAAGAGCGT
ATAGGAAAAGACGACGCAATGCCAAACATAGGCGAGAGCTCTGGCACAAT
TGAGGAAGCTCCAAGGTATGCGCGGGCTGCTGCGGCCGATGCTGAGGACG
GGGATGCCAACAGCGACGACGAAGGCGAGGACGACGCCACTAACGCCAAA
CAACGAAGCAGGAAAGCCGAAGCTGTCAGCTATGATAACCCAGACGACGA
TGAAGAGGAAATCTCCCGTCGCGCCCAAGCGTCTGATAGCGATAACGAAG
GTGAAGACCAGACGGATGAAGGACTAGGCACCGACATAAACATGCAGGAG
GATCGCAACCCGATAGACAAGGCCAAGGGAGGTAAAAAGGCTACCATCTC
CCACGATTGGATCTCTGACAACATCAAGAAATTCGAATTCGACAAGGAGG
GTGGCCAGTGGTGTGAAGTGAAACTACAGTATCCGGTTGAGGCGCCGAAG
GTGCTCATGTTACCTATCGTCGAGAAAGTTTGTCGGGAAACTGTGATTCA
CGAACTTAGTGGTATCGGGTCGGTAGCAAAGGTTCCGGCATCAGATATGA
CGAAGGAGGAACAGGCTGCGGGCAAGTGTAAATTGGCCGTGGAGGGTGTA
AATTTCAGCGCTTTTTGGAACGAACAGGAATCGATCGATCCCAACACCTT
GGAAACCAACGACATCGCCGCGTTCCTCCGTGTCTATGGAGTTGAAGCAG
CAAGGGGTAACATAATTAAAGAAATGAACGCCGTTTTTGGAGGTCACGGT
ATTTCCGTCAATATCCGTCACCTGAACCTCATCGCCGACACCATGACCCG
CGGCGGCGGCTTCACCCCCTTCAACCGTCAAGGCCTAAAGACCAGCGTGT
CTCCATTCTTGAAGATGAGTTTTGAAACAACATGCAATTTCCTCACCGAA
GCCGTGAGCGAAGGCGATTTTGACTCTCTCACTAGCCCCAGCTCGAGAAT
CGTGCTAGGAAAGTTATCAGGGGTTGGGAGTGGGAGCTTTGATGTGTTGG
TTGGGGGCTTGCAGGGCCAGCTCGGGCAGACTCCGTTGTACTAGGGAGTT
GACAATAGTCGGGTCCACTTCCAAAAAAAGATGCGGCATTTATATGTGGA
CTAAACTAATTTAGGAAATGTGAGTGACATCTGGTGAGTATTTTTTGGTG
TTGGTACAAAGTCGGGTCCAGTTTGGGAGTGGGGAGTTCCACAAGCAATA
TCTAAT

Sequences in the Contig:

SY0AAA24YK12FM1 SY0AAA24YK12FM2 SY0AAA24YK12RM1
SY0AAA46YK23FM1 SY0AAB26YF05FM1 SY0AAD62YB01FM1
SY0AAD62YJ09FM1