Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1292
Length(NT) : 176
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 24

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1292
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGGCGGCCGCACAACT
TTGTACAAGAAAGTTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTT

Sequences in the Contig:

SY0AAA14YD21FM1 SY0AAA21YI05RM1 SY0AAA24YH16FM1
SY0AAA26YM08FM1 SY0AAA29YJ16RM1 SY0AAA33YE19FM1
SY0AAA46YK22FM1 SY0AAB15YB18FM1 SY0AAB25YC19FM1
SY0AAB34YP03FM1 SY0AAB35YA14FM1 SY0AAB37YP13FM1
SY0AAB45YP22FM1 SY0AAB50YA11FM1 SY0AAB50YO18FM1
SY0AAB57YF12FM1 SY0AAC12YA21FM1 SY0AAC33YH16FM1
SY0AAC43YI07FM1 SY0AAC57YG12FM1 SY0AAC6YM09FM1
SY0AAD30YN10FM1 SY0AAD4YN14FM1 SY0AAD9YO16FM1