Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1291
Length(NT) : 662
Best Gene Model Blast : Link to GSTUMT00002524001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_01611
Accession: ref|XP_363685.1| Score: 449 E_value: 5e-43
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01611 Score: 449 E_value: 2e-43
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3176 Score: 340 E_value: 6e-33
PFAM Definition: Sld5, Synthetic lethal mutants of dpb11-1 five. The GINS complex is essential for initiation of DNA replication in Xenopus egg extracts. This 100 kD stable complex includes Sld5, Psf1, Psf2, and Psf3. Homologues of these components are found also in yeasts and in humans..
Pfam Number: pfam05916 Score: 309 E_value: 2e-29
Swissprot: Q4IQM6|SLD5_GIBZE

Sequence:
>Contig1291
TTGGCAATTTTCTTTCCAACCCCGCAGCTCAAAGTTATCCCAATCCCGTT
TTTCCACCGTGCTGCTTCTGCTGCTTCTCATCTAAACCAGGCACACGACA
ACCTCCACAAATCCTCGATCACAACATTCCATCCCATCTCATCCCAAAAA
AGAAAAAGAAAGAAAAACCCCCGCATGGACATCGACGACCTTCTACAAGA
ATTGGACGATAACAAGGTTCTAGGCGGAACGCGAGACATAAACGACCTCA
CACAGTCGTGGATAGCGGAGCGAACGGCCCCGGAGATCCTGCCCTTTCAA
ACTGCATTGCTGGAAAGGTTAATGGAACGGATCCGACAGCAGATTGAATT
GGTAGAGACACAGACAGGAAATTTGGATCCGAAGACGAACTTCTGTCTTA
TCCTTCTGCAGACGGAATTGGAGAGGGTAAAGTTTCTTGTCAGAGGTTAT
CTTCGGGCGAGGATACATAAGATCGACAAGTATTCAATATACATCCTAAC
GACACCTTCAATCCGTGGTAGGCTATCGCCGCCCGAGCTATCGTACTTGA
AATCTCACCTTGGACTTCTTAATTCACACTTTCTGGCATCCTTTCTCCGC
CGATTTCCTGAACAGTTGCGCCGGCTGGACGATAAGGCCGGGGGGATATC
CATGGTCGAGGA

Sequences in the Contig:

SY0AAA46YK13FM1 SY0AAB44YI01FM1