Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1290
Length(NT) : 1396
Best Gene Model Blast : Link to GSTUMT00008338001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1290
TTGGGGAAGCTCCCGTTTCCTCCAAACACCACTTGTATGACACAAGTAAG
AGTACGAGTCAGTACTCGTATGAGATACTAATGAGATACTAGCACTTTCC
TCCCACCTCAAGCCCCCAATAAACAAGCATCCACTTTTAAATACAGGTAG
GATACCAATGGTGCACCGTAATTCGCCCCAAGGTGAGTCACAACCCCTGC
AACCTGGTTGTCTTGTATTACTTGAGGAGCCTCTTTTTTCGGCAGGGATC
AGCCCATGGGGAAAGCGGTCAACGCCCAGCGCCAACACCCCTCCATAGCT
CCCTCAACACCTACCCACCCTCCTCCACTCGACACTCAAAATCCCCATTC
CCTTCCACCATCTAACGACGACGACAACAGCGGGTCGGGGAATCTCGCGG
CAAGTTACATTTTTCGCCAGGGGTGAAGGACCATCATGGAGCCCCACCGA
CAGTACAGTCCTATTGAAACTGCTCTCCTATGCCACGAACCTATCGTTAG
CTCCGTCCTTGCTTATCTCGCTGTTCACGAAGTGGTGATTCTAGCGAGCA
CTTGCCATCCGCTCCGCTCTTTCCTGTTCTCTCACTCCGGTTACTGGCGC
GAAACGAATCTGTGTCCATGCCCACCCGAGCTGGCTCTCAACCCGAGAGT
TATGAGATGGGATGGGCCAACTGAGCAATTGGACCACTGGCGTCACAAGT
TACTCTCGGTCTACAAAGCACCTTACAATCGACCCGATGACTACGAGCTT
CTCACCATTTTTCTCCGAACCCTCTTCGTTCGGAACCTGGTGCCTACCAT
TCAAATTACCAAGCTTGTCTTCGACGGGTTGCCCATTAAGAGGGACATTT
TTTTTGAGATCACCGACAGGTTGTCTCCTTGCTTACGGGAGTTGAGTGTC
AGGGCCTGTGCTGAGCTGGAGATGTCTGATTTTATCAAGTTGTTGGATTT
TCAAGAGCCCGCGCGACAGAGTCATTTTCCGCCTAATCTTAAGAAGCTCT
CTTGTTTTGGCACCGTGGTGTACGATGAACCCTACGAGATTCGGACCATG
AGTTTAAGCCATCACACCAGGAAGTCGTTGCAATTGTCGCTTTCTCATTT
CCGCACACTCTTGATTGCTCGGTCTCTCGAATGTGATATCGGCCCATGCT
TGCAGTGTGAAGAGAGGAAATTGGGGCTGCGCGGTGGTGACGTCTGCGCC
AATTGCGGTAAGGCTGACAACATTGTGCTGCATTAGTTGTGAGCACATGG
ACAATTTAGGGAAGAGATGCGCTAGTTGCCGGAGGGGCTTTTGTTCACCA
TGCCGTGATAAAGTTATGGAACGGTTGCCCGACCAACCCTCTTTTTGCAA
GGAGTGCATCGAACATGTCTCCTCATTCCCCGGTTGTGTCAAGTGC

Sequences in the Contig:

SY0AAA46YK08FM1 SY0AAB31YN10FM1 SY0AAB46YD24FM1
SY0AAB50YG21FM1 SY0AAD60YC09FM1