Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig129
Length(NT) : 1652
Best Gene Model Blast : Link to GSTUMT00005172001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_00222
Accession: ref|XP_001598136.1| Score: 388 E_value: 2e-35
KEGG Definition: hypothetical protein
Accession: ang:An15g00730 Score: 349 E_value: 4e-31
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3190 Score: 440 E_value: 5e-44
PFAM Definition: DUF947, Domain of unknown function (DUF947). Family of eukaryotic proteins with unknown function..
Pfam Number: pfam06102 Score: 491 E_value: 5e-50
Swissprot: Q3UFY0|CF153_MOUSE

Sequence:
>Contig129
CCCCCCCGGCAAGCTGAACTCTCTGATCGCTAGAACGAGAGCCTTTCCCT
TTCCCCTTCTTTTCCCTCTTCCTTTTATCCTTCCTAGGCTCACTCCCCAA
CACCCCCGGCGACCCTATCCCCTGGGCCAGATGGGCAAAGGAGCTAGTCG
TGCTCTTCTGCAGTCCACGGATCTCTTGGCCAGTGGGAGTCAAAGGGCTT
CTGTAGTTTGTCCGGAATGCAAAATCCATAGTCTCTCCGCGGGATGTACC
AGCGCGTTCATCCGGCCCAGTAGAAAAGGGCCCGTTTCCTCTACTAGAGG
TGCTAGTTTCCCCCGAATCCAAACCGGGGATCTCCCGCCTTTCCGACATA
GCGCCTATAGATCTTGTTTGTGGGTTCCTACACTGGAGCGCAACTAATTC
TTCCCTCAAAATCAGCCCAGCACCAAATGCACGATTCAGAGTTAGCGGGC
TCAGGAGTGGTTGGAGTGCGTGCATGAAAGAAGCCGACCGGAAAGTAGAT
GGGATTTCTATCGGAAGCTCCTGTCGTAGAGAAAACCACAGGCAAAAACT
GGGTCAAGGGTGACCATGTGTGGTACCGCATCTGGGTTAGGGTTGATGAA
ATCGAAGGTGGTGGGATTTCGGAAGCTAGCATCTAGTTAGTGCAATCTCA
AAACACCGTTTTCACTGCATAACAACCATGAGTTTTCGAAGGATCAAACC
ATTTGTTGACGACGATGGCAGCGGCCACTGTGGCCAGGAGAATGTTATGA
ACGATTCTGTTGGGTCTCGGGGGGGCAATAAGGCAGAAATTTCTGGCAGC
AATGATGACGGCACGACCTGGGGCGGCAATGAACCAGAAGATGGCGATGA
TGATATGGATATGGAGGGGGAGGAAAGTGATGAAGAGGAGCGGCCCAATG
CGCAAGTTGCTATATCCCACATTTCGTTCGGCACACTAGCAAAAGCCCAA
AAATCCATCGTAAGAGAGCGGCAAAGGTCACAATCACTCTCTAAAAGAGA
TTGGGTCACCGATACAAAAGCTCAATTAGCTGCTCTTAAAGAGTCACAAG
GGATAAAGCCCCTCAAACTTCAAAAGACACGGGAAGAGTTAAAACGTTCC
TCCAAGCACGCGCCCCAAGAAATCTCCTCCAAAAGGGCTGTTACTCGCCG
ACGAGAAGCGGTTGCTCCGATAATCCCCGCTGCGCAAGCTGCCAGAGATC
CTAGGTTCGACACCGCAGTTAAGGGGGTCTACGATGAAAAGGTTTTCAGA
AAAAATTATTCTTTTCTCGATGACTATCGGGAGGACGAGATGAAGGCCTT
AAAACAAGAGATTTTCAAGTCTAAGGATGAGCAGAAAAGAGAGCAACTAA
AGAAAGAACTTCTCTCAATGGAATCAAGACGCAAGACCGAAAAAAATAAG
GAGCAAGGCGAAAAGGTTGTCAGGGAGCACAGGAAAAGGGAACGAGAGTT
AATAAAGCAGGGGAAGAAGCCATTTTATTTGAAGAAAGCTGAGCAAAAGA
AACTACTCCTGGCGGAAAAATATTCCAAGCTCAACGAGAAGCAACTAGAA
AAAGTCTTGGAGAAGAAGAGAAAACGCAATTCCCAAAAAGAGCGGAAAAG
CATGCCCTTATCGCGCCGTGTTGGGTAGTACGAGCACTTTATTATTGCTT
AT

Sequences in the Contig:

SY0AAA14YM02FM1 SY0AAB41YD14FM1 SY0AAB60YP04FM1
SY0AAC38YB15FM1 SY0AAC55YK13FM3 SY0AAD59YA13FM1