Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1289
Length(NT) : 786
Best Gene Model Blast : Link to GSTUMT00004243001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 110 E_value: 3e-06

Sequence:
>Contig1289
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTCTCAACACCTTGGGATA
GCAAAAATTCGCCATGTCTTCACTCCACGACACTATCCAATCGTTAGAAA
GCCTTCTCGGCCATCAGCTCAACGCTTACGAAGGCTACAAAGCCCGCCTG
GCCACAGTCGATGCGACGGACTTTGCAGTAGCGAAAGACAAGCTTTCCGC
AGCACTTTCGCAGGTGCTCGGCCTCCTCGAATACCTGAAAGCGACAGACG
ATAGACTCTTAGACGCAGGGGCTCAGGAAACACATATTGAACCTGAGTTT
GAAAACCAGGCCGCATCTGTCCATGACCGCTTTCACGAAGCCGAAGGCGC
CAGCAGCCTCGGACTAGACCATATCAATAGACTAGCCACTGAAATAGCCG
AATTCCAAACAATCGGGCTCGCACGGCTAAGAGAGCAGATTAGCGCAGGT
AAAAGTCGACTTGATACGCTCTCAAGTCAGACCAATGAAAGATTGGCACA
TCTCGAGCGCCAAATTGGGGGAATTCAAAACAGAATCCGGACGACAAACA
ATGCTATCAGAGATGTTCAAGTACAGAAGGATTCAACCCAGAGTACTTTG
AATAACAAGAGAAACGAGCTGCACAACAAGGAGAGACAGCGAGACGCAGC
TAATGCAGAAAGTGCAAGGGCGAGAGAGCGGAGAGATGGCGCCAGGGCAG
CCGGTGTTGGTCTTGGAATCCTCTCCATATTTGCGGGCCCATTGGCCCCA
GTCGTCTTCGCCGCTACGGCAGGAAGTCTTGCTTAC

Sequences in the Contig:

SY0AAA16YM09FM1 SY0AAA25YJ11FM1 SY0AAA2YM06FM1
SY0AAA33YE12FM1 SY0AAA46YK01FM1 SY0AAB15YF15FM1
SY0AAB17YC11FM1 SY0AAB52YM05FM1 SY0AAB6YK11FM1