Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1288
Length(NT) : 1013
Best Gene Model Blast : Link to GSTUMT00003906001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CHGG_07042
Accession: ref|XP_001224698.1| Score: 568 E_value: 2e-56
KEGG Definition: hypothetical protein
Accession: fgr:FG09936.1 Score: 544 E_value: 5e-54
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3133 Score: 310 E_value: 3e-29
PFAM Definition: Pex19, Pex19 protein family..
Pfam Number: pfam04614 Score: 398 E_value: 2e-39
Swissprot: Q60415|PEX19_CRIGR
Gene Ontology:
GO:0005778 = Cellular component: peroxisomal membrane

Sequence:
>Contig1288
TTGGCAAGCTGCCCAGCCGGTAACATTCCGTCAGAAAATCGCTTTCAATT
TTTCCCCCAAATCGCAACAAAGGTTCACAAACAGCTAATCCCACCATGCC
TCCTCCGTCAAAAGTTACAGTCGAAGAGGACTCCGATGATGATGATTTGG
ATGACCTTGATGATTTACTGGACGAATTCCAGAGTTCGCCCCAACCAACT
GGTCAACCCCCAGCCAAAACTAGCGATACCGGTGTCTCAAATGACAATCG
TGGCCCTTCCCTGGAGTCGCTCGATGATGACTTTGCTCGTCAGTTGCAGT
TGGGAATGCAGGATTTACTGGGCGAGATGCAGGACTCAAAAGAACTACAG
GACCAATTTGAGCACCTAGTGAAGGAGCTGAACGACGCCACCGCAGTACC
TAGTCCCATGCCATCGGCGCCGTCCAGCTCTAGACCGTCAGACCAAGCGG
CGGCCAACTTCCAAGACCGAATAAAGCAAACGATGGATCGCATGAAGTCT
TCTGGAGCAGAGGTTGACGCTGCAGTCGCTGGCTCCGAAGCTGAAGACTT
TTTATCGGAAATGTTGAAACAGATGCAAGGAGCGGCCGGCGAAGGAGAAA
GCGACGAGGACTTTTCCAAAATGCTGTTAAACATGATGGAGCAGCTCACG
AGCAAAGAAATTCTCTACGAACCCATGAAGGAATTGAACGAGAAATATCC
AGATTGGCTGAGGAGCAATGAGTCCAAGCAGCCCGCCGAGGACCTACAGC
AGTATCGGGAGCAGTATGGGGTGGTCAAGGAGATCGTGGCAAAATTCGAG
GAACCAGAATATAGGGACGAATCTGATAAAGACCGAGAGTTTATCATCGA
TCGCATGCAAAAGATGCAAGCTGCCGGCGCACCCCCAACGGAGTTAATGG
GGGAGATGGGACAAGGATTGAGTATACCTCCTGATGTCGACTCGAATTGT
GCGGTACAGTGATTGCTAGATGTGTGGAAATGCTCGTGGTAAGCTGTATA
TTAAAACGTATTC

Sequences in the Contig:

SY0AAA46YJ18FM1 SY0AAA8YM07FM1 SY0AAB53YJ02FM1
SY0AAD40YA18FM1