Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1287
Length(NT) : 1023
Best Gene Model Blast : Link to GSTUMT00007719001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: GTPase Rab7
Accession: ref|XP_001554031.1| Score: 533 E_value: 9e-76
KEGG Definition: Ras-related GTPase; K07897 Ras-related protein Rab-7A
Accession: aor:AO090120000329 Score: 526 E_value: 8e-75
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0394 Score: 561 E_value: 2e-58
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 384 E_value: 1e-37
Swissprot: Q9C2L8|RAB7_NEUCR
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1287
TTGGCGACACTTTCGGTCAAAATGACATTTTCTCATTAAACACTATCATA
CCTCGTATTCAGGCTCATTACCGTATTGAGGCTTTGTGTTGCAACCAGAC
GCTCCCGAGCCTGTTATCGCTTATCTTAACTTAACTTAACTCTACTGCCA
GCTAGTCCACTACAACGCTTCTCTGCCACTTTCACTCTCCCCCAAACCCC
TCAAGGTCCTCCACTCCTCACTCACACAAGCCCTCCCCCGCCTCCTCAAA
CCTACCCGCACGCAGTTATGGCAACTAGAAAGAAGTTCCTCAAGGTAACC
TTTCGCACCTGTTCCCACGAGCATACGATCTAACTACGGGGCGTCCCTGC
GCCCTAGGTTATTATCCTCGGCGACAGCGGAGTTGGAAAAACATCGCTTA
TGAACCAATATGTGAACAAAGTGTTCAGCGTGAGCTACAAAGCAACCATT
GGGGCCGACTTTCTGACAAAAGATGTGATGGTCGATGATCGGCTTGTTAC
TTTGACTTTGTGGGACACCGCCGGGCAAGAACGCTTTCAGTCACTAGGCG
TGGCCTTCTACCGCGGAGCTGACTGCTGTGTTCTTGTTTACGATGTGAAT
AATGCAAAGAGCTTTGATAATTTGAATTCTTGGAGAGACGAGTTCCTGAT
TCAGGCTTCACCGAGGGATCCCGATACGTTTCCTTTCGTAAGTATTCTGT
CCATCTATCTAATTCAGTGTCCCTAAGCCACTGGCTGATGGTGTAGGTTG
TGCTTGGGAACAAAATTGATGTGGACGAGTCTAAACGCAGGGTGTCGAAT
AAGCGGGCGCAAGCATACTGTCTCTCCAAAGGCCAGTTACCACACTTTGA
GTGCTCGGCGAAGGATGGTGCAAATGTCGAGGTTGCGTTTGAGGCTATCG
CGAGGCAAGCTCTTGCACAGGATGAATCTGAAATCGACTACTTTGATCCG
ACTGTTAATACTGGATTCCCGATAGAAAGTGATGGGTGTAGTTGTTAGAG
GATATTCGTTCTCCTCAACCGGA

Sequences in the Contig:

SY0AAA46YJ09FM1 SY0AAB54YC01FM1 SY0AAD48YL05FM1