Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1286
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00002230001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein NCU00693
Accession: ref|XP_965833.1| Score: 422 E_value: 7e-40
KEGG Definition: hypothetical protein
Accession: ncr:NCU00693.1 Score: 422 E_value: 3e-40
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1004 Score: 308 E_value: 3e-29
PFAM Definition: No Hit Found
Swissprot: Q08285|RRP40_YEAST
Gene Ontology:
GO:0000177 = Cellular component: cytoplasmic exosome (RNase complex)
GO:0000176 = Cellular component: nuclear exosome (RNase complex)
GO:0000175 = Molecular function: 3'-5'-exoribonuclease activity
GO:0006402 = Biological process: mRNA catabolic process
GO:0042255 = Biological process: ribosome assembly
GO:0006364 = Biological process: rRNA processing

Sequence:
>Contig1286
TTGGCATACCCTCCCTTCCAAAGATCACCATGTCCCTAGTGGTGCAGGTG
CGCTTTCCGGGGGAAACTCTCCCCCCACTTGAGGACGAGAAGAAAAACAC
GACCTTCAAAGTCGGCCCTGGTCTAACGCATATTTCACCTTCGACACTTA
TCGTCAGTAGAGCTGGAGAACTCAACATAGACCAGCGAAAGCACACCATC
TGGATGGAGTCTAACAGTAAACGTTATGTTGCTTCTCAAAATGATGCCAT
CATAGCTACAGTTCTTCGGTCTACCGCGGACTCTTACATCTGTGCCATCC
CCTCCTCAAATTCACCAGTCCCATCGGCAAGCCAGGCGGTATTACCTCAC
CTCGCGTTTCCTCAAGCAACGAAGAAAACTCGACCCGTGCTTCATCAAGG
CTCAGTTGTCTATGCCCGCATAAGCCTCGCAAACAAGCATATAGATCCCG
AACTAGAATGTTACGATGCTGACAGCGGCAAATCTGAGGGGTTTGGGGAA
CTGAAGGGAGGTTTTGTCTTCGGAGTTAGTCTAGGAATGGCCAGGAGGCT
ACTTGGAGATGCGAAGAAAACCAGGCTGCTCAGGGTGAGGGAAAGAAAGG
CGGAAGCGGGGAGAAAGGGGGAAGAATACCAGGATGTCGGAGTCGATATG
AGCTCCGGAAGGGAAGTGTTGGAG

Sequences in the Contig:

SY0AAA46YJ04FM1 SY0AAB22YB22FM1