Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1285
Length(NT) : 1365
Best Gene Model Blast : Link to GSTUMT00010169001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: longevity-assurance protein 1
Accession: ref|XP_001211666.1| Score: 1132 E_value: 1e-121
KEGG Definition: hypothetical protein
Accession: ani:AN2464.2 Score: 1127 E_value: 1e-121
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1607 Score: 654 E_value: 6e-69
PFAM Definition: LAG1, Longevity-assurance protein (LAG1). Members of this family are involved in determining life span. The molecular mechanisms by which LAG1 determines longevity are unclear, although some evidence suggest a participation in ceramide synthesis..
Pfam Number: pfam03798 Score: 504 E_value: 1e-51
Swissprot: O59735|LAC1_SCHPO
Gene Ontology:
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane

Sequence:
>Contig1285
TTGGCATCAAACTGTTGCCATTGAGTTCGCTTTTGTTGCTGTCTTTGGGG
TCCATTGGCTTTCGTCAACCGGGAAAAGGAGGCTTAGAGCAGAGGACACA
TACGAGTTCGAGAACCCCACCGACACGAATTACGGGTCCCATTGCTTTGA
AGAGAGTTCACACTTGGACCCCAGAAGTTCGGGCGGGAACAAGAGCAGAA
AAATATGGGTAGACCGAGACGAACATCCTCCCTGGGCGAGGACATCCGGG
GTGATACTTCAGCTCCTGGAATATCAACCATGAGCACATCCCACGCACAG
AGAGCTGCTTCACGAAGTCGACGAAGGGCTTTATCCAAACCTCGGCCACC
ATCGAAATCCCGAGCTCAGAGCTTTTTCACCTGGTACCGCGAGATCTCTT
ACCGCAGGACATGGATAAACCCCCTGGTGGCTATGGCCCTGGTAATGGGA
GCTTATGGCTTGAACCCCACTCCCGAGAATCCATTACATGCTTGTATTTT
CTTATCCTATCCCGAACCTCCGGATCCGACCTCACATGCGCCTACAGAGA
CGCAGTATGGTAAAGGAATGAACGACTTTCTCTTTGTTCTATTTTACACC
TTCTTCTTCTCTTTCACTCGTGAGTTCCTCATGCAGCAGGTCTTGCGGCC
GCTAGCGATCTGGTGTGGTATCGCCAAGAAGTCCAAAGTTTCCCGCTTCA
TGGAGCAGACTTACACCGCAATCTATTTCTCTATCTTCGGCCCATTCGGG
TTATACGTAATGTCTAGAACACCAATCTGGTACTTTAATACTACAGCATT
CTACGAAAGATACCCGCACTATACCCACACAGCCGATTTCAAAACCTACT
ACCTCCTCCAAGCTGCATACTGGTCGCAACAAGCGATAGTCCTAATGCTC
CAACTTGAGAAGCCGCGCAAGGACTTCAAAGAGTTGGTATTGCACCACAT
CGTGACCCTCTCACTCATAGGCCTCTCCTACCGTTTCCACTTCACTTGGA
TCGGGGTTGCCGTTTTCGTCACCCACGACATTTCGGACTTCTTCCTCGCA
ACTTCCAAGACGCTAAATTACCTCGACCACCCATTCACAGGTCCATACTT
TGCCTTCTTCATTCTCGTTTGGATCTACATGCGTCACTACATCAACTTGA
AGGTCATCTGGTCCATTCTCACGGAATACGAGACCGTCGGAGTCTGGGAA
CTCGACTGGGTCACCCAAGTGTACAAATGTCGCATCGCACAGGTCATCAC
AGGCGGTCTTTTGGGTAGTCTGCAAGCAGTGAATCTCTTCTGGCTATGGC
TAATCTTGAAGATTGCGTGGAGATATGCCGTTAGCAACATTGCCCAGGAC
GAGCGCAGCGATGAT

Sequences in the Contig:

SY0AAA26YF03FM1 SY0AAA46YI21FM1 SY0AAA56YB23FM1
SY0AAB29YE21FM1 SY0AAB42YG14FM1