Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1284
Length(NT) : 762
Best Gene Model Blast : Link to GSTUMT00008190001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_07678
Accession: ref|XP_001798010.1| Score: 626 E_value: 1e-69
KEGG Definition: hypothetical protein
Accession: fgr:FG01560.1 Score: 627 E_value: 6e-69
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0257 Score: 488 E_value: 5e-50
PFAM Definition: Aminotran_1_2, Aminotransferase class I and II..
Pfam Number: pfam00155 Score: 282 E_value: 4e-26
Swissprot: O14209|YDT4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1284
TTGGAGCACTTCTACTTCGCAACATCCGCCCCTCGGTTCCCAGGATCTCT
CCCGGGCAGTTACGAACGATGATAAAACCTGCTGCGAGAGTAGCTACCCA
GGCCAAAGATGTTTGGTCAATTGTCAACGAAGCAGCTGCGGCAGCCACGG
CTTCAGGAAACACAATTATTAATCTTGGCCAAGGCTTCTTGTGGGTCGTC
TCCTTCTTCCTCCTCTTCTACCCACAAGACACATGATATAAAAGTTTGTT
TGTCTAATTTTTTTTTCCCACCTTCGAAAAAAACAAAACAATAACAGTGG
CTACAACCCGCCTCAATTTATCGTAAATGCTGCGAAAGAAGCGCTGGATA
GGGTTGACTGTAACCAATACTCTCCCACTCAGGGCCGCCTCCGCTTGCGC
CAGGCTCTCTCGGATGCCTACTCTCCATTCTTTGGCCGTAAGCTCGATCC
TGCCACTGAAATTGTTATCACCACCGGTGCAAATGAGGGCATTTTGAGTG
CCTTTATGGGCTTCATCGAGAAGGGTGACGAGGTGATTGTCATGGAGCCG
TTCTACGATCAGTATGTTCCCAACATTCGGATGGCTGGTGGAAAGGTTGT
CTACGTCCCGCTGCATCCACCCGCGAAGGGGGACACGGAGGTTTGTTCGT
CCAACGATTGGACCTTGGATTTGGCAGAGCTTGAGAGGGCTATCACTGAT
AAGACTAGGATGGTGGTCATCAATAATCCGCACAATCCGATCGGTAAAAT
CTTTAGCAAGGA

Sequences in the Contig:

SY0AAA18YB13FM1 SY0AAA46YI09FM1 SY0AAB61YI17FM1
SY0AAC37YC15FM1 SY0AAD42YL07FM1 SY0AAD4YJ17FM1