Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1283
Length(NT) : 627
Best Gene Model Blast : Link to GSTUMT00003036001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: ankyrin repeat protein, putative
Accession: ref|XP_001315507.1| Score: 128 E_value: 7e-06
KEGG Definition: ankyrin repeat protein, putative
Accession: tva:TVAG_299470 Score: 128 E_value: 4e-06
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 117 E_value: 4e-07
PFAM Definition: No Hit Found

Sequence:
>Contig1283
TGTAGCGGTGTCCAGCCGCAGTAGCTCCGGGCGTCGACCTTTGCCCCGGA
AGCTAAGAGCATCTTAGCTATGCTCGCGTTGCCGTTGCGAGAGGCGTGGT
GTAGCGCTGTCTTCACCGGCGGGAGGATGGGGGATTGTGATAGGATGTAC
TCTATTATCTCGGTGTGTGAATGCTTGCTAGCCCATTCTAGCGGCGAGAG
GCCCAAGTGCGGCAGTAGCGTGTGTCTGAGGAGATGGGTGTGCAGGAGGT
TGTAGAGATGTTTGCAGGTCTTGTGGAGGTTTGAGAGGGCGGAGGTAGGC
AGCGTGGAGGAGATCTGAAGAACGAGCTCGTTCGGGAGGGCTTGGAAGGG
CATTTGTATGGGATTATTTTTTCTTTCTTCTTCTTCTGTGCTATGGAATC
ACTATCGCTGTAGTGGGAGATTGCGTGAATCGCGGGGCGGGGCGATTGTT
TTGGGCTGAGGGAAGTTCGATGGGAATCGCCGGTCCGGCAAAGAATTTAA
TGTGCCATGCATACACGATTCATACCCACCGCAGATGCTATGTAGGGTGC
TGGGTGAGCGAGACATGGTGGGTGTGGAATGGGAATCATGTCTGCTCATA
ATGCCGGAGAGTTTTTAATCAGGCCAA

Sequences in the Contig:

SY0AAA46YI07FM1 SY0AAD49YE02FM1