Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1282
Length(NT) : 1221
Best Gene Model Blast : Link to GSTUMT00008573001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001596871.1| Score: 1134 E_value: 1e-122
KEGG Definition: conserved hypothetical protein; K05758 actin related protein 2/3 complex, subunit 2
Accession: mgr:MGG_04745 Score: 1110 E_value: 1e-119
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2826 Score: 988 E_value: 1e-108
PFAM Definition: P34-Arc, Arp2/3 complex, 34 kD subunit p34-Arc. Arp2/3 protein complex has been implicated in the control of actin polymerisation in cells. The human complex consists of seven subunits which include the actin related Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc. This family represents the p34-Arc subunit..
Pfam Number: pfam04045 Score: 810 E_value: 5e-87
Swissprot: O14241|ARPC2_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1282
TTGGCTTTTCTACCCCGGCTTTGCACCCTGCCAATTAATTCATCACAGAT
CCTAATCATCAACATGCTTCTTCTCGAGTATCACAACTTGCTGCTGAAGT
CGATCCTAACTGAGCGATTCAATAGTGCAACTGCAGCCTCAATCGATCAG
GTCATCTCCGACTTTGACGGAGTAACATTTCACATTTCCACTCCGGAGAC
TAAATCTAAGATACTTGTCTCCATCTCTGTTAAATGCTATCCAGATCTCC
TCCGGCATGGAGCCCAACAAGTCCTTGAACGAGAGTATGGACAGCACATC
ACTGAAACGGAAACTGGATATGACTTCTCCTTGATGGTTGATTTGGAAAA
TCTCCCGGCGGAACAAGAAGCTAAGGAAGACCTAGTCCGTCGCATATCGC
TGTTGAAACGTAATACTATGGCAGCACCTTTTGAAAAGGCTATCGATGAG
CACCACCGTCTCGCGGAAGCCTCTAAGGGATTCAATCCCGAGAATGCACC
TACAGGGGAGGGGACCGAGGTTATGGTTATTCGATATAGAGAAGAGGAAG
CGATGTACATCCAAGCCTCGCACGATCGCGTTACAGTTATTTTTAGTACG
GTATTTCGGGAGGAGACAGATAGGATATTCGGGAAGGTGTTCCTGTCGGA
GTTTGTGGATGCTCGACGGCGGGCTATTCAGAATGCGCCTCAGGTTCTTT
ATCGAAATGATCCGCCGTTGGAGATTCGTAATATTCCGGGGGTGAAGGAT
GACGGAACTGGAGATATTGGATATATTACTTTTGTCCTCTTCCCCCGCCA
TCTCACTCCTCAACGAAGGGAGGAATCCATATCCCACATCCAGACATTCC
GTGATTACTTCCACTACCACATCAAGGCTGCAAAGGCATACATGCATTCC
AGAATGCGCCGCCGCGTGGCAGACTTCCTTAAAGTCCTCAACAGAGCCAA
GCCCGAAGTCGAGGAATCAGAAAAGAAAGAGAAGAAGACTGCCAGCGGAA
GGAGTTTCCGTGTTCAAACCTAGGCTTTTTTAAACATTTTTTCCTTAAAG
TTTTAGTGACCATGTGTTCTTTGCCCCTTGATATGTGAATGTGTTTACGG
GGTGGATTTGGAGGAAAAAAAAGAGAAGGGTTTTTGTAAAGGGGGGGAAA
CTACTGTAGTTGATATCCTATTTCTCTCTTTAAAGGCTGATGCCGGGTTT
TATAATGGTTTGAGATGTTGG

Sequences in the Contig:

SY0AAA11YI15FM1 SY0AAA24YL03FM2 SY0AAA24YL03RM1
SY0AAA32YO04FM1 SY0AAA46YH24FM1 SY0AAA52YH02FM1
SY0AAA58YJ19FM1 SY0AAA9YB15FM1 SY0AAB6YG08FM1
SY0AAC21YD14FM1 SY0AAD41YM18FM1 SY0AAD44YK20FM1
SY0AAD62YK22FM1