Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1281
Length(NT) : 1294
Best Gene Model Blast : Link to GSTUMT00001241001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein BC1G_04975
Accession: ref|XP_001556357.1| Score: 1096 E_value: 1e-117
KEGG Definition: hypothetical protein
Accession: ncr:NCU03503.1 Score: 1058 E_value: 1e-113
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG0853 Score: 675 E_value: 2e-71
PFAM Definition: Glycos_transf_1, Glycosyl transferases group 1. Mutations in this domain of phosphatidylinositol N-acetylglucosaminyltransferase subunit A lead to disease (Paroxysmal Nocturnal haemoglobinuria). Members of this family transfer activated sugars to a variety of substrates, including glycogen, Fructose-6-phosphate and lipopolysaccharides. Members of this family transfer UDP, ADP, GDP or CMP linked sugars. The eukaryotic glycogen synthases may be distant members of this family..
Pfam Number: pfam00534 Score: 236 E_value: 2e-20
Swissprot: Q8X0H8|ALG2_NEUCR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig1281
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAAAAAACAAAATACTGAG
ATGAGGCTCGGTGTTGCCGTTGCATAGGCGGTCAGGGTGTCAGGGGCTCG
CTCCATCGCCTCCAGACTGAAAAGAACAACGCCAAATGTCGAGAAAGCGG
ATTCTATTCATCCACCCAGACCTGGGAATCGGAGGGGCTGAGAGGCTCGT
CATCGATGCTGCCGTAGGACTCCAACAGAGGGGTCACACGGTAACACTTT
ACACCTCTCACTGTGATCAAAGACACTGCTTTGACGAAGCCCGCGATGGA
ACGCTTGACGTTCGTGTCGCTGGGAATACAATCCTTCCACCGAACCTTTT
GGGACGCTTCAACATTCTCTGCGCCATATTACGACAGGTCCACCTCACGC
TGACCTTGCTCCTCACGGGTGAGATATCGAAGCACGACTATATTTTCATC
GATCAGCTCTCAGCCGCGATCCCTTTGCTTCGCTTCTTCTCGCCGCCAAC
CAAGATTCTGTTCTACTGCCATTTCCCCGATTACCTGCTCACCGCGAGGG
CTTCATTCATCAAGAGTCTTTACCGTATCCCCTTCGATTGGTTTGAGGGC
TTCACCACCGGATTGGCCGACACGATTGTCGTCAACTCGGCTTTCACAAG
ATCCGTCTTTGCCACCGCATTCCCGAGGATCGGGCTTGTTCCAAGGGTGG
TGTATCCGTGCGTCACTACTGCTACCATCGCTTCGCCCTCGAGGGCTATC
GATAGCGATCCGCCCCTCCCGGGTGATGGGAGAAAGGTGATACTCTCCAT
CAACAGGTTCGAACGGAAGAAGAATATAGATCTGGCAATAGCCTCGTATT
CCCTGCTCGCCCGGGAGCAGAGGGGTCGATCGCGCTTGGTCATCGCCGGA
GGCTACGATGCCAGGGTCTCGGAGAATGTCACCTACCATAGCGACCTGGT
GATGCTTTGTGAGAAGCTAGGCCTCAGATCCGCCACTTCGCGAAATTTTA
TATCGAGCTTATCGGTGCCGGAGGATACGGATGTGCTGTTTTTGCTTTCC
ATCCCGGCGACACTCAAAAATTATTTGCTCAGGACGGCCTCGCTCCTCGT
CTACACTCCTGCTCAAGAGCACTTTGGCATCGTTCCGCTGGAGGCCATGA
TTGCTGGTGTTCCCGTCCTAGCGCACAACTCTGGTGGACCCTTGGAAACG
ATTGAGGAAGGGAGGACGGGTTGGCTAAGGCCAGCGGAAGGTGTGCAATG
GGCTGCGGTGATGCGAATGGCATTGTTCGAGATGGAGGAGGGGG

Sequences in the Contig:

SY0AAA28YB23FM1 SY0AAA46YH21FM1 SY0AAA49YI11FM1
SY0AAB16YC12FM1 SY0AAB33YJ24FM1 SY0AAC26YC12FM1
SY0AAD34YA06FM1