Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1280
Length(NT) : 891
Best Gene Model Blast : Link to GSTUMT00009633001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_07893
Accession: ref|XP_001591267.1| Score: 344 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: ncr:NCU02669.1 Score: 334 E_value: 9e-30
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O42930|PEP1_SCHPO

Sequence:
>Contig1280
TTGGTAAGCAACCACACAAAATATTGGAGAAGTGCAAGTGCACTAGGCAC
GACTACGAATGCGATTTCAATTATCAACGAGACAAAGATGGCGCTTGTTA
TTTGGTAGAAGGACTTACACCTCCAGATCACCAAGCAGTTTGTAAGGAGA
ATAAGGACCAAGACGAGTACTGGGAACCAACTGGCTATCGACGCATTCCC
ATGACAACATGTGAAGGGGGTCAGGAGTTGGATAAGTCCATATCACATTA
TTGCCCCGGCCACAAAAAAGAGTGGGAGAAGAAACATGGTGGCGCTCGTG
GGTTTGCCTTATTCCTAGCTATTATAGCACCAATAACTGCGGCTGCCGTG
ATTGGATGGTTTGTTTGGACTCGCCTTTTGGACGGCAGATTTGGAGCCAT
CAGGCTTGGAGAAGACAACAATGGACAATCTCCATTTGTCAGATACCCGA
TCATTGTGATATCCGCTATTGTGGCTCTAGCAGTTTCGATTCCGACAATA
TTGGGAGCTATCGGTTCATGGGCTTCCAGCAAACTGACGAGAACGAGGCG
GTACACATCTAGAAGCTCATTTGCGAGAGGAGCAGACTACTCTGTTGTGA
ACACAGATGAGGGAGAGCTGTTAGGAAGTGATGACGAGGATGAGTTTTGA
GATGATGAGAGACGATGCTCTTCGTTGTTGTGGGCGTGAGGGCGGTGTTC
GGGTTAGGATGTGGTATGGTTCGTGTGGTCTCAGCTTGAAACTTGTGGTT
TTATATCTTTCCCTTTTCGTAGCGTGATGAGCTATAATGATTAAGGATTG
GTTAAGGGGGTGGGCTATTACGGGACGGCGGAACGACATGAGGGACACAA
AAGTGAATGGCTGACAGAGTGGGAGTTATTTTTCGTGTATT

Sequences in the Contig:

SY0AAA16YC16FM1 SY0AAA26YI12FM1 SY0AAA3YG12FM1
SY0AAA46YH11FM1 SY0AAA4YN01FM1 SY0AAB18YB16FM1
SY0AAB55YL21FM1