Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig128
Length(NT) : 1234
Best Gene Model Blast : Link to GSTUMT00000215001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig128
TTGGCATTCCCCAAGCTCAAAACCTATACTGCTACGCCCTACCTCGCTAC
GATGCCTACGGCCGCTACATCGGTAGCTGAGACCACTACTCCTGAGCCAG
CAAAGAAACGAGCCTGTCCTCCGAAGAACTGCCCTTGCGAGTGGTGCGGT
GTAGTATTTTCCAAGTCAGGACTCGGGAGACACTATGACTATTGGGTTTA
CTCCGCAAGCCCTGGAAAACCTGATGAGAAGCATACGCTCGAAGCTATCC
AACGCATGAGGGAGATCCGGAAGGACGCCAGGAGGCTTAAGGGGTGTGAT
AAACTCGATCCGAAAGAGATCAAATCCCGCCAAAATAAACGAAACTACGA
ACGCCATAAGGGTAGGCACGTTGAGAAGAAGCGTGCCAAAAGGATGTCTG
AGATGGCTAGGAGCATGGTCTTGAAGGAGATTGCTATGGAGATTTCAGCA
ATTTCTGCACCCCCTACCTACCCAACTCTGGAGCCAGATTCCGAGGCCCT
CGTCAATTTTCCGGCCTTGGTCTATGCATTTCTCTCTCCTCCTTCGGACG
TTTTTGCTCCCTCACCTAATCGCAACCTCAGCTCCTGGGGCGACCAATTA
CCCGGAGCCACGGAATACGTTGCTCTTGGCGTAAAATTCAAACAGCCAGA
CCTCAGCAAGTGGTCCCAGAGACTAGACCAAGAGTGGCAAAATTGGGGAT
CGTTGTCAGAACTCGAAAAGAGCAAGCTTTGTTTCCAGGAAATTGGTCGT
GCCCTATCAAGGAGCCAAGCGGATGCCGCTACATACAAGCCGTACGCAAG
GATTCTTGGTAAACTAGGAGGTGAAGAGTTGGGGAATAGGATTATAAAAT
GGGAAGGTAGAGCTACTCAGCTTCGCGCCCAAAAGGGGAGAGCTGAAGAG
CTCCAGCTAGAGAAGGAATGGATGGCCACTAGAGATGACCAGCACCTCAG
CCATGACAACGCCCCGACCGAAGGTGGAGCCTCAGGTAGCGGCGAGGGTA
ATTGGGACAATGGCAGGAGGGGTGGAAGTGATTCGGGAACATCGAGCTCG
GGGGATGACACTGATTAGGCGCGATTGGCAATAGTTCCTTTGACTATATC
CTTCAAAGTGGTGACTACCAACTTATGCACCGTTCGGCAAAAATGCCACA
AAAAAACCATTAACAAGTATGGCATATCATACCAACCACACATATTTGTT
ATATTAACGAATAATGATCTCCATCTGTAGTCGG

Sequences in the Contig:

SY0AAA14YL17FM1 SY0AAA41YH04FM1 SY0AAB24YL06FM1
SY0AAB35YM01FM1 SY0AAB58YJ24FM1 SY0AAC32YN19FM1