Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1279
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00007352001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_05488
Accession: ref|XP_001795892.1| Score: 248 E_value: 9e-20
KEGG Definition: transcription factor
Accession: ecu:ECU01_0470 Score: 185 E_value: 1e-12
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2294 Score: 177 E_value: 4e-14
PFAM Definition: Fork_head, Fork head domain..
Pfam Number: pfam00250 Score: 195 E_value: 4e-16
Swissprot: P42128|FOXK1_MOUSE
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0043565 = Molecular function: sequence-specific DNA binding
GO:0016563 = Molecular function: transcription activator activity
GO:0016564 = Molecular function: transcription repressor activity
GO:0045892 = Biological process: negative regulation of transcription, DNA-dependent
GO:0045893 = Biological process: positive regulation of transcription, DNA-dependent
GO:0006357 = Biological process: regulation of transcription from RNA polymerase II promoter

Sequence:
>Contig1279
TTGGCTTTCGGCCAAATCTGAAAAACCCTCTGCTCTGACCCAAGAACGAA
AGGGTCCAGGGCGACCTCCCAAAGGTATAAAACATGAGGTGCGAACTCAA
GCTCCGTTGCAACCACCACTCCAACAATCTCCATCTCCCACTCAGCAACC
ACAACAAGAGAATTCTGCAAATTCTCAACAAGATACCGAGATGTATCTCT
CTTCCTATCGCGACGACCTGCAAGAACTTGCACCCCTAGCGGCTGCCAAC
CTAGCTATGTCTATGCCGATTGACCCCGCTCTTTCCTATGATTTGCCCCA
GGAGCATGCCCAACCTGCGCCAGCTGTTTTCCAGCAATCTCCGAAGAGGG
AAAAGGGGGGAAAACCAAAGAAGGAAAAACCACCCCCAAAGAGGAAGCGC
AGTCCCTCTCCCGAAATTAACGAGGCTGATTTTTCTCCTGAAGCTTTGTT
GAAACCTTCGGCCTCTTATGTCGTTCTTATTCATGAGGCAATTTCCTCCT
CCGAGAGAGGCGCCTTGACTTTACCAGAGATCTACAAGGCCATTGAGCGG
AAGTATCCTTACTACAAATTAAGGGTTACTACCAACGGATGGCAGAGTAG
CATCAGGCACAATCTTAGTCAACACAGAGCTTTCTACAAAGTCGAGCGCA

Sequences in the Contig:

SY0AAA46YH05FM1 SY0AAB47YI13FM1