Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1278
Length(NT) : 756
Best Gene Model Blast : Link to GSTUMT00009250001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_08975
Accession: ref|XP_001799278.1| Score: 138 E_value: 7e-07
KEGG Definition: hypothetical protein
Accession: fgr:FG04257.1 Score: 93 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: CDC27, DNA polymerase subunit Cdc27. This protein forms the C subunit of DNA polymerase delta. It carries the essential residues for binding to the Pol1 subunit of polymerase alpha, from residues 293-332, which are characterised by the motif D--G--VT, referred to as the DPIM motif. The first 160 residues of the protein form the minimal domain for binding to the B subunit, Cdc1, of polymerase delta, the final 10 C-terminal residues, 362-372, being the DNA sliding clamp, PCNA, binding motif..
Pfam Number: pfam09507 Score: 120 E_value: 2e-07

Sequence:
>Contig1278
TTGGGGGGACAACTTTGTACAAAAAAGTTTGGGGGGACAACTTTGTACAA
AAAAGTTGGAATCTTTGCTTCTTCGACCCCGAAACAGAGGGCTCACAATG
GGTAACTCTAAGAAATACCCGGAGTCTTCTATTATTGATGAATGTGAAGT
CGTAAGATTTGCTAGCTAAATTTCGGGGGGTGCGCGGTGGCTAACAATGC
GGCAAAATTTCAAGGTCACTTACCGCATGCTAGCGTGCAGACTCGAAGTG
CATGCCAATGTCGCGAAGCAGATGCTCTACGAGTTCCACAAGTGGTCACA
AGAAGAAGGATGAGAGTATCCATGCTACGTACATCATCACTTGCGAGCGG
AAGGTCATTGAAGAGGCCGAGGATGGTGATGATGATGAGGACGAAGATGA
GGATATGAACTTGAGCCCCTTTGAGGTTACACCGCGGGAAAAGAAGGAGG
GGTTTAAGTATCAGAAGGTTGTCAAATTGATTGGTGAGGAGAGACTTGAA
GAAGTTAAAGCGGAAATCGAAAACATCAAGACAGTTCACGTTCATAGTCT
TAGACCGAGCAGGATTAAGGATTTGACTGTGTCGTCGGCTTGCTCGGAGA
GGGTTCGCGCGGAATTCATTTATGAGGATGAACATGCTGCGGGAAGCATT
TAGGGCAAGATAGTTAATCGTGCCGCGATTAAAGCCCCGAGGCCGAACAG
GCCACCAGCCATACCGCATGCCGTGGCTACCGCGGCCGTGTCGAAGGCGA
GTGAGA

Sequences in the Contig:

SY0AAA46YG24FM1 SY0AAB14YG09FM1