Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1277
Length(NT) : 2271
Best Gene Model Blast : Link to GSTUMT00011658001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215362.1| Score: 196 E_value: 7e-13
KEGG Definition: predicted protein
Accession: aor:AO090120000470 Score: 182 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1277
TTGGCAATTGTGATACAAGTACAGTACAAGTACTATCATATCAGACCCAA
ACGTTATACCCTGTATTGCCTTTTTCTCTTACCATACTGAAATGTCCTTC
GAACATGTCAAAATTTTAGGCCGACGAAATTTTTAGGGCAGGCTCTTCTG
GAGCTATTCTGTCGAGAGAAAACGAAATGGGTGGATATTTTTTGATGATA
CAGGTAGCTAACATTGTTTACAAGTATTGAAGATGATGTAGGCGAGTGAC
TACCCGTGTCGCCTTCTCATAACCTCAATGGGAAAGGAGCGGAAGTTGGA
GATTATGCTGATGTCTGAGACATCAAAATTCAGGGGCAGAGAGGCTTCGT
GCCCCCCTTGCCCTTCACCCACGAGATGAGTCACTCTTTTGTGACTTGCA
AGGATAACTTCTTATCATACAAGTACTAGTACGGTACCATTACAGTGCTG
TGGATACTGATCTAATCTCTCTGGATCGCGGAAAATCATGACTGTTCGGA
CGGATATATGATACAGACATTCTTTTCAGCTTTCTTGATATCACTGAGGA
CGAATCAATTACAACACGGCAAAGTGCCAAAGTGCTGGTGCCGTATGATA
CGTAGGTGAGAAAGGCCCTCAGATTAGCGGCCCTGGTAGTTATCGCCCGT
GATCCAAAAGGGCGAAAGAAGCTTAAATCATTCCAAGGGATGGCCTGTCC
CTATTGTTACACAAAATCGGAGGGATAAATACCCGTTGTCAACATTTCAC
CCACAACCTATACTATTTATTTACTGTTGACAAAAGGAGCCACGAACGAA
CAAGCGCAAACCAAAAGACGAGAAAAATGTTTGACTTTCTCATGAATCCT
GAACCGGGACGGAGCTCTGGGAGACCTCAACTACCACTGGACATTGTTTC
TAGCATCATCTCCCGGATCGAATCACCGGCAGACCTTGCCCGTGTTAGTC
GAAGCAGTCGAATTCACCACTTCCTAACTGTCCCTTTGCTCTATAAGAAC
GTGGTTCTCATTTGTAGACATGAGGAGAGAAAGCCTTCCATCACCTTGGC
GCAGATGGGGGCATTGCTCAAGCCCGGTATTGCAGCCTGTGTGCGACGTT
TGGAGGTTATCAGTGAGAAGCCATCAGGTCAGGACCGGCGAGGTGAAGAT
CGTGGGGTGTGGGCTGTCGCGGTGGTGGGGATAATCTCCGGAATGAATAC
GCTGGAAGAATTCCTATGGAATTCAGAATCAATGATGCATCCTATCCTTT
ATGAAGCGCTATCTAGACACCCGAAATTGAAGGGCCTGAGAATAATACAT
CCACTCTCACTTCATCCCCCTCCCCCACCTTCGTTTGCGCCTCCGATAAT
CTTTAGAAATCTGAAGAGTATACACCTAACAGGCCTCGGTTCCCGAACAA
CATACAATTGGGGTATGTCTTCAATGCCGGCACTCCAAATTTTCAAAGTG
TCTTGGAGGATCTCGACTAGGTTAAGCGTCATCTTCCCAGAACAAAGACC
CGCCAAAAGTCCCCGAGTTCTTAAGGAACTCCATATAAGCAATGTGGTAC
TAGATATACCAATACATCAGTGTTTGGATTTGGTGGAGCTTCAAAAACTT
TCACTACTTGACTGTAGTGTTGGGGAGTCATCGTCATGGGACGAGATATT
GTGTGCTGAAGAACAGAAAGTCGCCAACTCTGGATCACCCGCAAGTGCTT
TATCGGGAGGAGATGGAGGCGTCACGAGGCAGAGCCCTAAACCCAGAGTG
AGGCGCTTGAAGCTAAAGAGCCTTCGGATAAACGATGTGGGGAAACATTG
GATAAGCTTCCTCTCCTCCTTCGCTGGCCTGGAAGAGTTATACATCCTTC
CATCAACCAGCGTGATAGAAGAGGAGGCTGTTGAGCCCTTCCTCGACGCG
ATTATAAACTTCCACGGCTCTACAATCCGCAACCTCCGTCTAAGCACCAG
CCAGCCAGTCGAGAGACGCTGCGCCTCAAAACTGGTTCGCTCTTGCAAAG
GTCTTGAGGAGGTGTCCTTGCGGATACCAAAATCCGAATGGAAATTTATA
GAGATACTAATCCTGCTTTTGACACGCATTCGCGTCTTTCAACTCTTGAC
GACGGACCTATCATCCCACGCGGAGGAGTACGATGAACTGCTTGCACATC
GGGAGGAATCAGAACGCCAAGTCGCCCAGGGAGGGGAATCATTGATGGAA
ATCTTTGGCTTTGGTACTAAGTGGGCGTGGGTTATTGACCGGACGCCTAG
CTGGGTCGATGGCGTGGATCC

Sequences in the Contig:

SY0AAA20YN22FM1 SY0AAA42YE21FM1 SY0AAA46YG16FM1
SY0AAB3YD03FM1 SY0AAB41YB12FM1 SY0AAB48YL13FM1
SY0AAB53YN20FM1 SY0AAC20YD18FM1