Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1276
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00008581001 E-value : 1e-166
Numbers of ESTs : 2

Blast Results:

Nr Definition: transcription factor TFIIH complex subunit Pmh1
Accession: ref|NP_596334.1| Score: 155 E_value: 5e-09
KEGG Definition: hypothetical protein
Accession: spo:SPBC776.18c Score: 155 E_value: 2e-09
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3800 Score: 207 E_value: 1e-17
PFAM Definition: MAT1, CDK-activating kinase assembly factor MAT1. MAT1 is an assembly/targeting factor for cyclin-dependent kinase-activating kinase (CAK), which interacts with the transcription factor TFIIH. The domain found to the N-terminal side of this domain is a C3HC4 RING finger..
Pfam Number: pfam06391 Score: 238 E_value: 4e-21
Swissprot: O94684|TFB3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005675 = Cellular component: holo TFIIH complex
GO:0005515 = Molecular function: protein binding
GO:0000079 = Biological process: regulation of cyclin-dependent protein kinase activity
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig1276
TTGGCGGACATTCTCGAGCCATCTGCAATGATTCAGACATCAAGCGAACC
ACAACCCGGAGGAGGAAGGGAACGTACTTATTTTCGTAATAGTCTTGAAC
GATATAGTGTTCGTTAACATCACTGAGCCCGCCAAGAGGATCGAAGGGGC
CATCTTCAAGGACTCTCTTCCTGGTCCCCGCCAACAGCGAAGAATTCAGC
AACGATCGCCCCTCAGCCAGACTTTTCAACTTCATCTGCTCATCAGCCTG
CCTCCTCTTCCTCTCCCCAGACCTCTTCAACTGCACCTCCTGGATAACCT
TGACAGCACCCTTATCCCCACTCGCCAGCGCATTCAAGGTGGCAATCTTC
AACTCCTCCTGTTCCCTGCGCTCCTCCTCCCGCTCCCTGACCGCCATCTC
CCTCGCCAACCTCTGACTCTCCTTCTCCGCCTCAGTAGCTTGTGCGAACG
CCATCATCTCGGCAGCCTGTCGGGCCGCATTAGTACTAATAAGCTCCTTA
TTCGCCGCCTCGTACTCGAGAAGCTTCGCCTCGGTCTCCTTCACGTCGAT
CTTGTTCACCAAATTGAACGTGATCTGCTCCACCTCCTCCAGATAGTCAT
T

Sequences in the Contig:

SY0AAA46YG06FM1 SY0AAD14YI14FM1