Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1275
Length(NT) : 1889
Best Gene Model Blast : Link to GSTUMT00011292001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_08044
Accession: ref|XP_001240881.1| Score: 1251 E_value: 1e-135
KEGG Definition: hypothetical protein
Accession: ang:An07g08890 Score: 1212 E_value: 1e-131
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53252|PIL1_YEAST
Gene Ontology:
GO:0032126 = Cellular component: eisosome
GO:0005741 = Cellular component: mitochondrial outer membrane
GO:0005515 = Molecular function: protein binding
GO:0004860 = Molecular function: protein kinase inhibitor activity
GO:0006897 = Biological process: endocytosis
GO:0008104 = Biological process: protein localization
GO:0009408 = Biological process: response to heat

Sequence:
>Contig1275
TTGGGCTTTTAAACTCCAAAAACCTAAGATATTTCTTATTGGAGTGGTTG
CTGAAAATACTTTGGGGATTGAGGCTGGGAAATATTTCTCGGCCAAGTAT
TCCGGCTGCAAAAGACTCTCACCATACTCGTACTCGTACAGTAATGATGG
AGCACAGTACCGTACAACACTCGTACTCGTACAGTGCGGCGCGCCACGAT
CGATCGGACCAGGAGTCGAATTGTCTCAGGGCTCGCTACTCGGGGGTGAA
GGAAGTGGGATCCATCCAGACCCCCCCACTCAAGCCTTAAATGCCTCCAA
GATTCCCAACAGGTACCGTTGGGATTTCACAGCTAGAGCTCAATACTGCT
AGTTCTCTAACCGTGCGTACTCGTACAAGCGCGATTTCCCCCACCGCCTT
AGGTCCTTATGACGGGAGTGGGACGTTTGCAGGGAAAAAAGGATCGCCTG
GTGCATCATTCCCACGACAGTTAGTCTCAGCACGGCTCCGTTGGTTCTCC
GGTACTCATTCTTCACCCAGGCTTCGCTCACACTCACTCACTCACTTTCT
GAACGAAATTTGGTGACATCATGGCAACGGTGGTCTGCGTCATTGCTGGG
TGGAGGGAGAGGGAGGGAGGGAAACGAACAAACTTCCTCCTCCACATTCC
AACCGCTCTTCCCCTCTCTTCACTCTGCCATTACTTCTCCAGGCAATGCA
TATTAGCAGCTGATTCCCTTTCATCTACTCGAGTATCAGTCCTTCTTCCT
TCCTCGCTTCCTATCGTTTGATCGTACTTTGTGCGTTAATCCCTTCTCCG
GTGATACCATACTGGTATCAATCCTCGTTCCCGTTGAACCAGGCCATCCT
TGCACTTCTCATCCGGGCACCCCCACATCTGTTGATCAACCACCTCACCT
CTTTACCATCACCCCCATCATCCTTTTATTCCTGCGAGAACGAACATCAT
CAATTGTAGTAGTCATGCATCGAACTTATTCAATGCGCCAGTCGCGCGCA
CCAACCCAATCACAGATTGAGAAACCACCTCCACCACCTAGTAGCACCAA
GGTTGGCAGGTTGTTTGGTGGGGGAAATTTTGGTCATAACCTTCGTAAAT
CTATGGCCGGCGCATATGGACCGGAATTGGCAAAAAAGCTCTCGCAACTC
GTGAAGATGGAGAAGAATCTTATGAGGTCTATGGAGCTCGTTGGCCGTGA
GCGCCGTGATGTTGCTCGGCAGCTTTCTATTTGGGGAGAAGAATGTGATG
AGGACGTTTCAGATATCACCGACAAGTTGGGCGTGCTCATATTCGAGATC
GGAGAGCTTGAGGATCAGTTCATTGATCGCTACGATCAGTATAGGGTTAC
CATCAAGAGTATCAGGAATATTGAAGCTAGCGTGCAGCCTAGCCGGGATC
GCAAACAGAAGATCACGGATCAAATTGCCCAGTTGAAATACAAGGATCCG
AATTCTCCCAAGATCGTTGTCCTTGAACAGGAATTGGTTCGTGCGGAGGC
CGAGTCACTTGTTGCTGAGGCTCAGCTGTCAAATATCACCCGCGAGAAGA
TCAAGTCTGCGTTCACCTATCAGTTTGATGCGCTCCGCGAACACTCGGAG
AAATTGGCATTGATCGCGGGGTACGGGAAACACCTATTGGAACTTATCGA
TGACACGGCAGTTACTCCCGGTGAAACTCGAGAAGCTTATGACGGCTACG
AAGCGAGCAAAAGCATCATTCAAGATTGTGAGGATGCTCTCACCAGCTGG
GTCGAATCAAAAGCGGCTGTTAAACCACGTTTGTCTGTGCGTGGTTCTCG
CCAACGTCGTACTCACGGTCGTGGAACTCGCAGTGGAAATATTGGTGAGC
CAGTCTCTTTGACCGACCAGGATAGACCGATGCGTGGTT

Sequences in the Contig:

SY0AAA46YF05FM1 SY0AAB45YI24FM1 SY0AAB47YO12FM1
SY0AAC12YE01FM1 SY0AAC41YO01FM1 SY0AAD24YB03FM1
SY0AAD40YL23FM1