Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1274
Length(NT) : 846
Best Gene Model Blast : Link to GSTUMT00008999001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 307 E_value: 2e-26
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 303 E_value: 3e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1274
TTGGTCCCCCAATCGTCAACATCTTCCACACTTCCTCACCTGTTCAATAT
CTATTCAATTCTCACGTCGATAGAGCCCGACCTTTCGCAACCCAAGAATA
GATCGAAAATATGAGCGGCCAAGAACCATGCACTTCTTTCCATGGTATTT
CCTCACCCCCACGGTATGCGCGGAAATTGTCCCTTGTGTGCATCTGCCGT
TGCGATTGCTGGTCTCATTCACTACACTTCTAGCTCGAGCGCCTACAGCA
ATATCCGAGGCGATTATAGCGGCAATAGTGGTTCCAATAACATCACGAAT
TCTGGTAATACGAACTCTGGTAACACAAATTCCGGCAATATCACCAACAA
TTACTACGGCGACGCGAACTCGCCTCCGCGCGATTCCGAAATTTTGCGAT
GCTTATACACGTCGAAATACCAGTTACATCGACATCGTATCCGGGAGCCG
GCCCAGGGAACGTGTGTCTGGGTGCCCGAACATCCAAAGTATAAGGAGTG
GCTAGGGAAACAAACATCTGGTCTCCTCTGGCTATCGGCGGACCCTGGTT
GCGGAAAATCAGTCACCGCTTCATTCCTTGTAACGCATCTCGCCACCCAC
ACTGATGCTATCGTTTGCTATTTTTTTTTCAAGGACGAATACGAAGAACA
GAAGAGCGCAACCTTCGCTCTATCCGCCATACTACATCAGCTTTTTAGTG
GAAGAGACACGCTCTGCTGGTATGCCGAGAAATCGTTTAAGGCGAAAGGG
AGGAGCATTACGGAGGAGGTAGATACTTTATGGGATATTTTGGTTAAAAC
AGTGGCCGAGGGGGGGTGCGGGGAGGTAATCTGTGTGGTGGACGCC

Sequences in the Contig:

SY0AAA46YE24FM1 SY0AAA63YB16FM1 SY0AAD23YO01FM1
SY0AAD60YD15FM1 SY0AAD60YO05FM1