Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1273
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00006934001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: ubiquitin conjugating enzyme
Accession: ref|XP_001536308.1| Score: 525 E_value: 7e-52
KEGG Definition: hypothetical protein
Accession: ang:An06g01040 Score: 515 E_value: 5e-51
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0425 Score: 508 E_value: 2e-52
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 361 E_value: 2e-35
Swissprot: Q9Y818|UBC15_SCHPO
Gene Ontology:
GO:0030466 = Biological process: chromatin silencing at silent mating-type cassette

Sequence:
>Contig1273
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGACCTCCCGCGTCAAACC
TGCCTCCTTCCTCCACACCCCTTCCTCCTCCACAAAGGCTATCTTATCTA
TGATACCACCCCTCCATAATCCTCCCCTCTCCCCACCTGTGTCTGTAATC
TACAACACCCCCCCTCCACCTGTCTGAACACCCCCTCCTCCGCCCAACCT
CCCTTCGGTAGGGTACGCTTTCACCCAGACAATGTCGGCTCCTCTCGCCT
CCGCTAAGCTGCTGCATAAGCAGCTAAAGGAGATGCAAACGGACAAGGAC
CTAGCAAGCATCAGTGCAGGTCTTGTGAATGATAACATTTATGAGTGGGA
GGTTATTTTGATGATCTCCGACGACTGCAAATTTTACGGAGGTGGTTTTT
TTCGTGCCCGCCTCGTGTTCCCGCATACCTATCCGCATGATCCGCCAACC
ATGACATTTGAAACGCCCATTTGGCATCCGAACATCTACCCAAATGGTAG
TGTTTGCATTTCGATTCTCCATCCTCCCGGGGAAGACCAGTACGGTTATG
AGTCTGCTAGTGAGCGTTGGCTACCCGTTCGTACCCCAGAATCGATCCTT
ATATCGGTGATCTCTATGCTGAGCTCTCCCAACGACGAGAGCCCGGCCAA
TTTGGAGGCCG

Sequences in the Contig:

SY0AAA46YE02FM1 SY0AAB44YH23FM1