Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1272
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00005596001 E-value : 1e-104
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_363345.1| Score: 147 E_value: 3e-08
KEGG Definition: predicted protein
Accession: mgr:MGG_01271 Score: 147 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1272
TCCGCCGCCTCCCAATCCACATAACCCTCTACAGCCGTGCAACGTGCAGC
CTCTGCGATACAGCACGCACCGAACTCTCGCAGGCTTGGGAAAAGCGGCC
ATTCGAGTACGCTGAAGTAGATGTGATGAAGGACGACAAGTGGCGTGTTT
ATGTACCCAACCTTCATTCCTAGCAAGTTATAGCTGCGGTTAAGTTGATT
GGGGGAGAATAGGAATTCGACGTCCCGGTAATCCACGTTTCCCGGACAAT
CGGGGAGAAGGGTATCGAAGAGGGCGAGAAGACGCGAAAGTTGATGCATA
AGTTTAAGGCTGCGGAGGTGGTGGGAGTAATGGAGAAGGTGTTGAGCGAG
GGGGGAGTAGAGAGGAAGGAAGGGGGAGTTGAAGACGGGCGCTCCTATTA
GATGCTGGCAACCGGTATCAACTCGATTTCCCCTGCCAAGCCGGATGTTG
GAGATTGAGTGAAACTTGATGAATCGATCAATAGAAAATACGAAAAATAT
GTGATAGGATGGACAAAGGGTGCGGCGAATAGGTCAAACCCTGCACCGAA

Sequences in the Contig:

SY0AAA46YD15FM1 SY0AAB25YC13FM1