Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1271
Length(NT) : 1009
Best Gene Model Blast : Link to GSTUMT00001615001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_12411
Accession: ref|XP_001548813.1| Score: 735 E_value: 7e-76
KEGG Definition: hypothetical protein
Accession: fgr:FG01207.1 Score: 667 E_value: 3e-68
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0895 Score: 276 E_value: 3e-25
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 298 E_value: 8e-28
Swissprot: Q6DG60|UBE2Z_DANRE
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>Contig1271
TTGGGGAGCTCGCTTCGTCGTCTCTTCATAGCTGCCCTTTCACTTCACCC
TACTTACCTTTGAGCTCGCGTGCGTCCTCTCTAGGTTCTTCTTTGCTACC
GTGCCCCCCCTCCCCTCCTTTCAACTTTACTGCCCTGCCCAGACCGGATC
TTCCACGCTGTTACCTTATACTCCCTCACCTCCACACCCCTACAAATAAC
ACTCCCCACCGCACCTCTTCTACTCGGCCTCTCATTCTTGTGCAGTCTCT
CTCCACTTCCGGCTCCGTCATCGCAGACATGAACCAATCCGTTATCCGAT
TGACTAGGGAGCTCAACGAGATCAGAAAATCCAACGATCTATCCATTGCC
GTGGCTTGTAGGGAGTCTGATGTTCGCAATGTCAAGGCTACTATATTAGG
ACCCCCCGATACTCCTTATGAATTTGGTTTTTTTGAGTTTGCATTGAAAT
TCGGCAGAGACTACCCCACCAAGGCCCCGACTGTCACTGCACTCACCACC
AACTCCGGAAGGTGCCGGTTTAATCCAAATATATATGCCGTTGGCAAAGT
TTGTCTATCGATTCTTGGTACTTGGAGGGGTGACCGTGGCGAAGAATGGT
CTTCTGCCCAGGGGTTGGAATCAATTTTGATTTCGATCCAGAGCCTCATG
TCTTCTAATCCGTACGAAAACGAACCCGGATTTGAGAACGCAAACCAGCC
ACACGATAAGGATAATCAGAAAGCTTATGTTCTCAAGATCCGTCATGAAA
CCCTCCGTGTTTCTATTATATCTAGACTGGAAGACTATTTGGGCATCAAC
CCTGACGGAACCGTCCAACCACCACCAATCATTCCAGAGCAGGATATCTA
TGATGATGACTCGAGCATGATGGATTCGGAGGCCTCTGCGGTTTTTGAGC
CTTTCAAAGATCTTTGTAAACGCCGGTTCCTTTGGTATTATGATACCTAC
CTCGCCTCCATCAAGGTTGAGAGTGAAAAGGTCACCGATGGTGCGCAATT
TACTAAGAT

Sequences in the Contig:

SY0AAA46YD12FM1 SY0AAB33YF10FM1 SY0AAD10YB23FM1