Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1270
Length(NT) : 1002
Best Gene Model Blast : Link to GSTUMT00001613001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: transcription factor TFIID complex subunit Taf3
Accession: ref|NP_593833.1| Score: 243 E_value: 8e-19
KEGG Definition: hypothetical protein
Accession: spo:SPAC823.06 Score: 243 E_value: 4e-19
KOG Definition: No Hit Found
PFAM Definition: Bromo_TP, Bromodomain associated. This domain is predicted to bind DNA and is often found associated with pfam00439 and in transcription factors. It has a histone-like fold..
Pfam Number: pfam07524 Score: 160 E_value: 8e-12
Swissprot: Q12297|TAF3_YEAST
Gene Ontology:
GO:0005669 = Cellular component: transcription factor TFIID complex
GO:0016251 = Molecular function: general RNA polymerase II transcription factor activity
GO:0000114 = Biological process: G1-specific transcription in mitotic cell cycle
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig1270
TTGGGGGGACAACTTTGTACAAAAAAGTTGGTATCCCCCCACATACCGGT
AACTCATCCTCCGTCCATTCCTTCTCCTCCTCCTCCTACAAGCACACCCC
ACAAGAGGGAGAGATAGAGAGAAGAGAGAGAAAAGGGTGAGCGAGTTCCT
TTTTCAACAGATAGATATAAAAAAAAAAAAAAATAAGAAAAAACATGACA
GACTCAGAAGTCTACTTCACCATCCTCCGAGTATCCGCCGCACAAACCCT
CCGCTCCGCCGGCATAACCGCAGCGAAGCCCTCCGTCGTCGACGCGTTCA
CAGACCTCCTAGCCCGCTACCTCACCCTCCTGGGCACTACGACCCGCAAC
TTTGCCGAGTCCGGCGGCCGCACGCAGGCAGAGTTAATAGATGCCCGCAT
GGCAATGGAGCACGTCGGTCTCCTCCGGCCGATAAACATATTCAGCAATC
CCGACGACGACGATACGGAGGCCGTGGATGCGCTTGTGGAGTGGTTTCGT
GGGCCGCAGGCCGCGGATATGAGGAGGGTTGCTGGCCATGCTGAGAAGGA
GGGGCAGGTTGGGAAGAGTGATGAGTGGTTGGGCGCTACGAAGAAATTGT
CGGAGAAGAGGAATACTACGGTGTAAGATGGGAACCCGATGGGCCGTAGC
GGTGGGGAGATCAAGAAAGGTTGTCGTTTGGATGGACGTGGTAATGGCGA
CGTTGGGTGTAATACGGCGCAGCCGGGATAGAAAAAGCGAGACTAGAAGG
ATCTCTATATGGGAGAGGAATGGGTGGAAAGCCCAACCGGACCGGAGGTA
TACCTTTGGCAGCGGACGGCGCACGAGGTATGTGTGGGCCATCAGGTAAA
CCCCCAATACCCATTCCCTCTCTCCTCTCTTTTTTAACATGTATCATAAT
CCCCAGCCCCCGCACCCATCCACGGTGCCAGCGGTATTCCCATATTCCAT
TCATGTAATAGCTAAGGCGTTCCGGGTTTCTTTCTTTTCGTCTATATGAA
AG

Sequences in the Contig:

SY0AAA30YL16FM1 SY0AAA30YL16RM1 SY0AAA44YM19FM1
SY0AAA46YD08FM1 SY0AAB40YE08FM1 SY0AAC33YE19FM1
SY0AAD38YC03FM1 SY0AAD45YD13FM1 SY0AAD7YM06FM1
SY0AAD8YO04FM1