Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig127
Length(NT) : 685
Best Gene Model Blast : Link to GSTUMT00006401001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_09738
Accession: ref|XP_001589105.1| Score: 387 E_value: 8e-36
KEGG Definition: hypothetical protein
Accession: fgr:FG09768.1 Score: 366 E_value: 1e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0715 Score: 295 E_value: 1e-27
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 238 E_value: 4e-21
Swissprot: P87239|MDJ1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig127
TTGGCACCAGGTAAACAGCATAAAAAACTCCAGAACACTTTCTATTCAAG
ACGCCTGATTGCCACGTCTGCAAGTGTCGGTGGTGAGCGATAATCATGAG
CTTCATTCCTCCAGTATTACCGAGGGCTGTCCGTGTTCTACGGACATCTT
CAAATCCTATCACAAATTTCAGATGTTCCTACGCTCCGACACTCCCGAGA
TCACTGCCGGTCCCGAGAAATTCCAATCACTCGCCCAGGAGATCCTTTCA
TAGCACTCCAAGGTCCCAAGCATCAGTAAAAAATCCTTACTCCGTCCTCG
GCCTTGATAAAAACGCATCCACCTCCGCTATCAAGAAGGCATACTACTCA
TTGGCGAAGAAATGGCATCCAGACCAGAACAAGGACAGTTCGGCGAGGGA
AAAGTTCCAAGAAATCCAATCAGCATACGAGATTCTCTCGGACCCGGAGA
AGAAGGAACAGTTTGACCAATATGGCGAAGCAGCATTCAAACCTAGTGCT
GGGTTCAATCCTGGCACCGGAGCCGGGTTCGGTCAGAGTGGATTTCGCGA
GGGCTTCCCAGCAGACTTTTCGTTCGAGGACTTGTTTAGTGCATTTGGTG
GCAGTAGTGGGCGGGGGACGAGTGGTTCTGAGGGGGGGATACCGTTTGGT
GATAACATTGAGGTTGAAACAACAATCTCATTCAT

Sequences in the Contig:

SY0AAA14YL03FM1 SY0AAA37YN15FM1 SY0AAA50YG01FM1
SY0AAB23YL10FM1