Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1269
Length(NT) : 1210
Best Gene Model Blast : Link to GSTUMT00003257001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1475 Score: 116 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1269
TTGGCATCCCACCCTTTATCAAACCCATCGTGCATCCCTCTTCTCCTCTC
ATCTTCACTGGACCGTCAACCAACCGGATCAAAACACAGTAACAATGGCC
ATGTCCTTCGGTCGATTCCTTGCTCGCAACATTTTCACCTTGGCCAAGGC
CAATCCCCTTCCCCTCTGCCGTCTCCATGCCATCAACCGCTTCATCGACA
ACCCTTTGAAGGCAGAAGCAATTGGCATCCGCAATGCTTCGTCTAAAACC
AAGACTGCCACGGCAGGTGCAAAGGGGACCGCGAAGGGGGTGCCTGCCGC
CAAAAAAAAAAAAACTGCCGTGAAGACCACCTCGAAGAGAGGGACCGCTA
CCAAATCGAAATCCACTGCACTCAAGAAGAAGAAGCCGGTTGCAAAGAAG
AAGCCGGCTGCAAAGAAGAAGCCGGCCGCAAAGAAGAAGCCGGCTGCAAA
GAAGAAGAAGTCTACTAAGGAACTCACTCCCGAACAAATGAAGCGCCAAA
AAAAGCGTATGCTCAAGGAACACGTTCTCGCGCCCCCTAAGGTCCCCGCG
TCCAATCCGTATTCTACTTTCATGTCTCTCGAAGGGGTCACCGTAGGTGC
GGATGCAGCCAAAAAGTGGAAGGCACTTACTCCTGAGCAACAGCAGGAAT
ACGCTGAAAAGGGCAGAAATCTTCACGCCCTCGGTCTCCAGAATCGTGAG
AAATGGGTCAAGACCTACCATCCCCTCGAGGTTTACAAGGCCAACAAGGC
CCGTAAACACCTCAAGCGCTTGGGTGGTGGTAAAAAATTCGATGTGCTCA
AGGACCCTAGAATGCCTAAGAGACCTACCCCTATTGGTGCCGCATTCCTG
AGAGACCAGTGGAACGCTGGCACCTTTATCAATCCGGACGGGTCCAAGAT
GCCTGCTGTTTTAGCCCTAAAGCATTCTCGTGATTTGTACGAAAAGCTGT
CTGCTGCCGAAAAGAAGGTATACGAAGATCAGTTTGCGGCGGAACGAGCC
GTCTACAAGAAGGCGATGGCTGAATTGTTCGGGGATATTTCAAAGCTTTA
ATCGATCAGATTGAATAACGTAGGAGGCTTGGACTGGATGTACACGCTAG
GACTTGCTTTTTTCCATCCTTCTTTTTTCGTTCATACGACTTCTCGTTAC
GATCTATCATGTCGTAGACCTGGTCGTCGCTGTAGTTTGTTGTTGCTGTT
GTAGCAGTGG

Sequences in the Contig:

SY0AAA13YF16FM1 SY0AAA14YL04FM1 SY0AAA18YL21FM1
SY0AAA35YC18FM1 SY0AAA45YK16FM1 SY0AAA46YC18FM1
SY0AAA52YJ24FM1 SY0AAB22YD20FM1 SY0AAB46YG20FM1
SY0AAB46YH23FM1 SY0AAC23YJ17FM1 SY0AAC39YJ04FM1
SY0AAC51YJ10FM1 SY0AAC60YL17FM1 SY0AAD11YB22FM1
SY0AAD4YL08FM1 SY0AAD62YM15FM1