Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1268
Length(NT) : 1389
Best Gene Model Blast : Link to GSTUMT00007452001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: NADH-ubiquinone oxidoreductase 39 kDa subunit, putative
Accession: ref|XP_001258421.1| Score: 1265 E_value: 1e-137
KEGG Definition: NADH-ubiquinone oxidoreductase 39 kDa subunit, putative [EC:1.6.5.3 1.6.99.3]; K03953 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 9
Accession: afm:AFUA_6G12790 Score: 1258 E_value: 1e-136
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2865 Score: 690 E_value: 4e-73
PFAM Definition: Epimerase, NAD dependent epimerase/dehydratase family. This family of proteins utilise NAD as a cofactor. The proteins in this family use nucleotide-sugar substrates for a variety of chemical reactions..
Pfam Number: pfam01370 Score: 177 E_value: 1e-13
Swissprot: P25284|NDUA9_NEUCR
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig1268
TTGGGCGATAGGCTCTTTAAGCCCTTAAGAATCTCCACTCCCGCATTTAT
CCCTGCATCTTGTAGCTCATGTTCGCCGCTACGCAGAGCTGTTCTTCGAC
TTTACTGCGGAGCATCGTGATGAGGACGCAGTTGTTCAGGGTTGCCCCTC
CTATGAGGAGAGCGATTCATGATATCGCAATTACAAGGACCGGGAAGCCT
ATAATTCGGACCCCGGGGGGTGGCAGGTCTTCAATCGGAGGACATACTGC
GACTGTGTTTGGGGCCACCGGCTTCCTCGGAAGGTATATTGTGAACAGGC
TTGCTCGTTCGGGGTGTACCGTTGTCATCCCGTACCGGGAGGAGATGGCT
AAGCGTCACCTCAAAGTTACGGGAGATTTGGGCAGAGTTGTTTTCATGGA
ATGGGATATGAGAAATACGCCGTCAATTGAGGCGAGTGTGCGACACTCCG
ATATCGTTTTCAATTTAGTCGGAAGAGATTACACTACCAAGAATTTCACT
TATGAGGACGTCCATGTCGAGGCGACTCAGAGAATTGCGGAAGCTATCGC
AAAATACGATGTTGACCGATTCATCCAAGTTTCTTCTTTTAATGCTGACA
AGAATTCGCCTTCCAAATACTATGCTACTAAAGGTCAAGCTGAGGAAGAT
GCCCGCGCAATCTTCCCGGAGACAACTATTGTCAGACCAGGCCCGATGTA
TGGATTCGAGGACAGACTGCTCCACAGACTGGCCGGCACAACCAATATCT
TCACTGCAAATAACATGCAGCAAAAGATGCGACCTGTGCATGTAATCGAT
GTTGGCAAAGCCCTCGAAGTTATTGCATACGACGATGCTACAGCCAGTCA
AACATTTGAGCTGTACGGCCCTAGGGAGCTCACTCTCAAGGAAATTGCGC
ACATGGTCGACAAGATCGTTCACAAGACACATCGTCACATAAATCTGCCA
AAGAAAGCTTTCCAAATGATTGCCTCCGTACTAGACTACTTATGGTGGCC
CACAATATCCCCCGACGAAATTGAAAGGCAGCACCTTGATCACAAAATCG
ATGCTACTGCAAAGACCTTCGGAGATTTGGGCATAGAACCCACGGATATT
GAGGCGGATATGTTCCAATACATTAGACATTACCGCTCCGCTGCTTATTT
CGACCTACCGCCGATGACGGAGAAAGAGAAGAGGCTGGAGAGACAATATC
TTCACGTACAGCAGGATCTCTAGAAAATAAGGAGAGAGACGAGAGGGATG
TGTGTTGTTATATTTAGGGAACATATATCCCGTAGAAAATCGTACATAGA
ATCACAACGCAGGTGTTTGCATCGTGACGGGTAAGACCCTGTATATACTG
TGTAGCTGGAAGGTATCTTCTCCGAAAGATAACTTTTAT

Sequences in the Contig:

SY0AAA46YC02FM1 SY0AAC18YJ07FM1 SY0AAC30YO08FM1
SY0AAC35YE17FM1 SY0AAC40YA17FM1 SY0AAD27YJ23FM1
SY0AAD2YO21FM1 SY0AAD36YA07FM1 SY0AAD42YA03FM1