Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1267
Length(NT) : 1508
Best Gene Model Blast : Link to GSTUMT00004289001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500585.1| Score: 233 E_value: 2e-17
KEGG Definition: hypothetical protein
Accession: yli:YALI0B06875g Score: 233 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O74415|YJL2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1267
TTGGGTGCTATGCGAGAGCTCGCTCTCTCATCTTTAACCACCACTTCTGA
TTTCACCAAGGCCAAGGAGATCTCACCTTACTTAACGGCACTACTCGAGT
CATTTTCTATGCCTGGAAAAGGTGCCGCTCAATTCGAATGGACAGTGAAG
GTAAGCGCTGGGGCCCGAAACCAGCTTGATAAGATTTTTGCCCGATTCCA
AGTGGACCTTCATAAGGATTTCCTGTCCCTAGAGCAGATTGATCTTCTTC
AACGAGCGGCGCCATTGCTCCCATCCCTAGATAAAGAGAAAGCACTCCAG
AATGGTAATACAAGACAGCAGAGGTATTAATCTCGCGGTAGAGACTGTCG
ACCTTATCGACTCTTTAATGGACTCTCGAGAAACAGCAGATATTCGAAGT
TGGGTTTTAGTAGCTATTGACTTCCTAACTCGGAGATTTTCGGAAGATGA
ATTACCGTCAGAGAAAGTCCTGAGGTTTGCAAAACGGTTAGGAGAATTAT
TCGCACAAGAAAGGATTGACCTATCAGCATCGGTGCCACGAGCTGCTCTA
AATGCTGTTCTTGAGTCTGGCCTTCAAAAACTCATTGACACCCCAGAGAT
AGTCTATTTCGTTTCGGTTGTGGTTTCACAGTTGGCCTCCAAGTCACTTG
ACGCTAGGAAGCTACTTCAAATGGTGCTCGGACACAGCGGGAACCCTCTT
TTGTTCCGCGGTGATACCCCCGATGAGATCTCACACCATATGGCGTTCGT
TATCTATCGCCTCTTTTCCGCTGCCAGATTATCTCAATCTACTATAACAA
CACTGGACGGAGTATTGGGATTATATCGCGGCACCAACGATCTTATAGAC
ACCGCTTTACTAAACATTATATGGAGTATCGAAGCGCATCTAGCCCAAAG
TTGCGCCAACAGGATTGCGGACTGGTCAATTCTTGAGAGAGCAGGAGGAA
AATCGTTTATTTCACGAGTCCGGGGTCGGCTTTTTGTCGCCGTGGATTCT
AAGAAACTTGCCAGGAGTGTCTTCCAATACTCTCCTTGCAAGGCGACCGT
GTCCGATGTAGATCTCAAAACACTTAAATCGTTCATGAGTGCTCGTGCTG
AACAGAGGGAAATCGATTCCCGGACGTACAACCCCGAGTTCTTGCTTCCT
GTTCTCACATATTGCCTAATGTCAGACAATGTTATTATTGATGCCCAGGC
CGCCGTTGAAAAACATACCCTAGGTTTCGCTATTATGGGTCTTTGCTCTT
ATCGTAAGAGTTCGAACAGCCAAGCGCGCAGCTATATTAAAACAGCTATT
GCAAAGTTAGAGGCTTCAGCATATCGGGAGAGAGCTCAAATCTTGCATCT
CCTTTGCGCCATCTTAGCCTCCTTTACAATCTACGAAAAATTGGATGCTT
CCCAACCCTTGCATATCCCGACAGTTGTTGGAGTTTTCCTTGCCCAATTA
GTCCAAGTCCTATCTAACCCAAACCACTTCCTCTATGAAAAAGTAATGGA
ACTCCTAC

Sequences in the Contig:

SY0AAA46YB15FM1 SY0AAB55YE01FM1 SY0AAC37YP06FM1
SY0AAC58YI21FM1 SY0AAD33YI08FM1