Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1266
Length(NT) : 795
Best Gene Model Blast : Link to GSTUMT00009120001 E-value : 1e-164
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1266
TTGGGCAAATAAACGTCATGCCTAAGCTTACTTACTAACTCGCTGACTAA
AAGATATCATGAACGACAAAGTGCACCAAATCAGATACAGGGCAAAAAAA
TTCAAAATCTCCAGCACCTATTCCTTTCACCCGAACTGGGAATAATAATA
AAAACATGGAAAAACACACACGGATGAAAATAAAACTAGCTGGTGGGTAG
GATGAGAAAGCAAGCAAGCTAGCGACTTAAGGCATAAGGATAATTTTCCA
ATAAGATAAACAAGGACGGGACCAAAAGAGAAAAAACATATCACTTTTCT
TATTGCTCTTCTAAACGAACGGAGCAGAATAGAGTGGAATGGGTTTACAC
CAAGGGCATCGCACACTGCTGATTAAGATCGTCCTATCCCCCAATTTCAA
ATCAGTAAAACCAACCCAAGAAGGCAAGAAAGGGAAGAAAGGGAAAACCT
ACCCAACAAAAAGCCCCCGGCGAAACCCACTGGCTCAAATCATGCATATA
ACTCCCCTGCAGCCAATTATCCAATTCCATATCCTGCGGGTACATATCAC
CCAATTGCGCCGCTGCCACAAAGCCCGGATTCACTATCGTTGCCGCTGCG
GCAGCCTGGTAGTACATTGATTCGGGAATGATACCTGTTGGTGAGGCGGT
GATTGATTCGAGGTGGTAGGTGTTTTGGTGATGGGGGCCGGCGAATGAGT
GAGTTGGGTAGAGGGAAGTGTCTTTGTACATTTGGTTTTGTTGGGGGGGG
CGGTGGGGCGGTGGTGGGGCGGTGGTGGGGTGGTGTGTATAGGTT

Sequences in the Contig:

SY0AAA3YE05FM1 SY0AAA46YB13FM1 SY0AAB32YN08FM1