Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1265
Length(NT) : 1183
Best Gene Model Blast : Link to GSTUMT00005221001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_09680
Accession: ref|XP_001799967.1| Score: 913 E_value: 2e-96
KEGG Definition: hypothetical protein
Accession: ani:AN6366.2 Score: 893 E_value: 2e-94
KOG Definition:
Classification: [Coenzyme transport and metabolism, Energy production and conversion].
Kog Number: KOG0534 Score: 779 E_value: 2e-83
PFAM Definition: FAD_binding_6, Oxidoreductase FAD-binding domain..
Pfam Number: pfam00970 Score: 337 E_value: 3e-32
Swissprot: O74557|NCB5R_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0016192 = Biological process: vesicle-mediated transport

Sequence:
>Contig1265
TTGGCCCAACACTCCCCGACTGTCCTCAAAAAGGAAACCCTCTCCCGTTC
ATTTTTACCTCATCCACCTTCCAGAGAAGTTCCCTTCCTCACTTCTGGAT
CTCCTCACCAGCAATCCTTTGCCGAACCAAGCACTCCTTTGGTCTTCAAA
CTTCGTTACAATTTCCGACCCCATGGCACAGAAACAGAAGAATAATCAGG
TGTTATTGAGCACACCTCTGCACGGATTGTACATTCCGGTGGGACTGATC
CTCGCGGGTACAGCTATTATCGACTATAACTATATTCCCCATGCTGCGGG
ATTGGCTTTGCTTCTTGGTGGGCTAAAGGTCTGGCGAGGCAATGCAAGAA
CAATCCTCAAGCCCGATCAATTCCAGGACTTTGAGCTCGTCGAGAGGACC
GCGATCTCGCACAATGTCGGAATTTATCGTTTCGCCCTCCCTCGAGCAAA
CGACATCCTCGGTCTCCCAATCGGTCAGCATGTCTCCATCACCGCTACCA
TTGACGGCAAAGAAATCATCCGTTCCTATACCCCAATCTCTTCCGACCTT
GACCGGGGCCACTTCTCCCTCCTCATCAAGTCTTACCCAACCGGTAACAT
CTCGAAGTACATCGCGAGCCTCAAGATCGGACAGACCATCCGCGCGAGGG
GACCAAAGGGGCACTTTGTCTACGCTCCCAACATGGTGCGTGCGTTCGGT
ATGATTGCTGGTGGCACTGGTATCACACCAATGCTGCAGATTATCAAGGC
CATTTTAAGAAACCCCGAGGACAAAACTCAAGTCGACCTTATATTTGCCA
ACGTCAATGTCGAGGATATTCTCTTGCAGGAGGACCTGGACGAGCTGGCG
GCGATTCACGACAATTTCAGGGTTCACTACGTTCTCAACAACCCACCGGA
GAACTGGGCCGGCGGTGTAGGATTTGTTACAGCTGACATGATTAAGGACA
AATGCCCCCCGGCTGCCGCGGACGTCAAAATGCTCATTTGTGGCCCCCCG
CCCATGGTCAGCGCCATGAAAAAGGCTACTAGTGCTCTTGGATACGAACC
TGCCAAGCCAGTATCAAAATTAGATCACCAGGTGTTCTGTTTTTAAAAAT
GAAGACATGCTTTATGACCAGCTTGGCAGACGGAGTTGAACCTTTTTTTG
AAGAGCTTCTGAACAGGAAAATACAGAGTATAC

Sequences in the Contig:

SY0AAA41YK23FM1 SY0AAA46YB10FM1 SY0AAD14YI18FM1