Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1264
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00009433001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1264
TTGGATATGAAGGAGTCACCGGTGGTTGATTATGAGCAGGGCTTACCCAC
GATGACGGCGACTCAGAGCATCAATAGGACCGAACCTAATGGTGGTGAAT
CAAGTTCTGCCATGGAAGCCGCTTCCCCACCTCTTAGCGATGATTTCCAC
AATGGGGAGGAATCTTCGGTCGCTGGCCTAGCATCATCCTCCACCAGTCT
CGCCCAGGGGTGGACTGTTTGGGGAACACCTCTGGTACACCCCCCAGGGG
AAACCGAACCTGCTATCTCTATGCCTTCATCGGATGACAATGGCGGTTGG
TTACCGGACTGGGAGCGGGACCTCATGCTTCAAGAACAGGTTCTGGTAGG
ATTGGAACCCGCCGGGGGTGCCGCCAGCAGCAGTGGTCGGACACCTAGCC
AAGGAAAGGGAGCCCAGGGTGGGAAAAAGAAGAAGTTCAAGAAAGTTACA
CTGATGACCAATGGGGGGAAACGCGGAGCTTAATGCGTGCATTTGTCAAA
CCAACTATCTGGTTGCTGTTCTGAACACCATTCACTTCTATCGTGGGTTA
TGCACTGCGTTCGTTCATCCGCTTTTTTTCCTTTTTTTAAACTGTTTAAA
TCTCTTCTTGCTCCTGC

Sequences in the Contig:

SY0AAA46YA04FM1 SY0AAD50YB11FM1