Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1263
Length(NT) : 875
Best Gene Model Blast : Link to GSTUMT00009618001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CHGG_08110
Accession: ref|XP_001225766.1| Score: 830 E_value: 5e-87
KEGG Definition: hypothetical protein
Accession: fgr:FG00302.1 Score: 815 E_value: 1e-85
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2863 Score: 957 E_value: 1e-104
PFAM Definition: Metallophos, Calcineurin-like phosphoesterase. This family includes a diverse range of phosphoesterases, including protein phosphoserine phosphatases, nucleotidases, sphingomyelin phosphodiesterases and 2'-3' cAMP phosphodiesterases as well as nucleases such as bacterial SbcD or yeast MRE11. The most conserved regions in this superfamily centre around the metal chelating residues..
Pfam Number: pfam00149 Score: 123 E_value: 1e-07
Swissprot: Q9UK59|DBR1_HUMAN
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0008419 = Molecular function: RNA lariat debranching enzyme activity
GO:0000375 = Biological process: RNA splicing, via transesterification reactions

Sequence:
>Contig1263
TTGGCCGTCAACAACTCGCCAAGGCGGTATGTCAGCAATTCAAATTGCTG
TTGAGGGCTGCGGCCATGGGACCCTAAATGCGATCTACGATTCGATAGCA
CGTACCTGCAAGATCAGTAGATTACCACTGGTAGACCTCCTCATCATCGG
CGGGGACTTCCAAGCGGTCCGAAATCTGCGGGATCTCAATGTCATGTCTT
GTCCACCAAAATACCGCGTTCTAGGGGATTTCCACGAGTACTACTCAGGT
GTCCGCAAGGCTCCAATGCTTACTGTATTCGTTGGTGGGAACCATGAGGC
TAGTTCTCACCTCTGGGAATTGCTATACGGTGGTTGGGTTGCTCCAAACA
TCTACTACCTGGGCGCTGCTTCCGTCATGAACTTCCGAGGGCTGAGGATT
GGTGGCCTGAGTGGGATTTACAACGGGCGGGATTATGCCCGCCTACGTGA
CGAGCGGTTACCATATTTCCCGAGCGAGATAAAAAGCATCTACCACGTTC
GGCAGTACGACGTCTTCAAACTTTATCAGATCAATGAGCCTGTAGATGTT
ATGATTAGCCATGATTGGCCAAGTGGAATCGAACACCATGGCGATTTGAA
TGAGCTTCTTAGGCGGAAGAGTTTTTTCAGGAGTGATATTGAGAAGGGAG
AGTTGGGAAGCCCGCCTGCAAGAAGCTTACTGAATAAATTGAAACCAAGG
TATTGGTTTTCTGCCCATCTGCATGTCAAGTTTGCCGCACTAGTGGATCA
TGGAAAGTCCCAGGAGGAGGGCGAGGAGGAAGTGACGGTGCAAATTCAAG
GAAAGGGGAAAGAGAGGGCGGTTAGCCCCGTAGAGAAGAACCCTGATGAA
TTGGATTTGGATATGGATTTAGCGG

Sequences in the Contig:

SY0AAA45YP18FM1 SY0AAB38YN02FM1 SY0AAC9YK20FM1
SY0AAD53YL18FM1