Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1262
Length(NT) : 1595
Best Gene Model Blast : Link to GSTUMT00012078001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_05468
Accession: ref|XP_001246027.1| Score: 1116 E_value: 1e-120
KEGG Definition: hypothetical protein
Accession: ang:An07g02210 Score: 1078 E_value: 1e-115
KOG Definition:
Classification: [Nucleotide transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG1448 Score: 770 E_value: 2e-82
PFAM Definition: No Hit Found
Swissprot: P32895|KPR1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005515 = Molecular function: protein binding
GO:0004749 = Molecular function: ribose phosphate diphosphokinase activity
GO:0006189 = Biological process: 'de novo' IMP biosynthetic process
GO:0006207 = Biological process: 'de novo' pyrimidine base biosynthetic process
GO:0000105 = Biological process: histidine biosynthetic process
GO:0006166 = Biological process: purine ribonucleoside salvage
GO:0000162 = Biological process: tryptophan biosynthetic process

Sequence:
>Contig1262
TTGGCTTCTTCTTTTCTTCCCCACGTCCTCCTCTCATCGCCTACATTATT
TTAGAACAACCTCCCACTATTAACGCTAGGCACTTCTATTTCCTCAATTC
GTCTGAGCGGTTAATAGATACAGATTCCGTAACGATCAAATTATTTCCTC
CCTCCCTCGTCATGCGCCGGGTCAAAATCTTCTCTGGCACGAGCCATCCC
GGTCTAACAGAGGCCATTTGCGAGCGTCTCGGGACAACACTGGGGAAGTG
TGATCTCAAGAAGTTCTCCAATGGTGAGACAAGTGTCGATATTGGTTGCT
CAATTCGAGACCAGGATGTCTTCATTGTTCAGAGCGGGAGTGCAAAGGCC
AATGATAGCATTATGGAATTGTTGATTCTTATATCTGCTTGCAAAGGCGG
ATCGGCTAATAAAATAACGGCTGTGATGCCTTATTTCCCCTATTCTAAAC
AATCTAAGAAGAAATCTCATCGAGGAGCTATCACTGCTAGAATGCTAGCG
AATTTGCTTACGGTTGCCGGGGTCGATCATGTCATCACTGTGGATCTCCA
TGCTTCCCAAATGCAAGGCTTTTTCACGAAGCCTGTGGATAACCTATATG
CGGAGCCGCTTCTTGCGAGGTGGATTAGACATACCGTTCCTAATTGGCGT
GATTCGGTTGTTGTATCGAAGAATCCGGGCGGGACTAAGAGAGTGACTCA
GTTAGCAGATGTCTTGAAGTTAAATTTTGCCCTGATCACGACGGATCGAA
GGCGCAAAGAGGGTTGGGCAAGCTCTCGTTTCCAGAGCCATAGGCATTCC
CCAGTTGAGAGCGTCAACGGCGAATCTGAAGAGAAAGATAAGCAACAGTT
TACTGCGGCAGAGGTTGATGGGGCTGTCGCGATCTCCAATATGCGGATTC
GCGATGCCCCTGAGGATGCGGCCGTTGATTTTGGCGCTACTCCGCGGGCA
GTTGCTCCTATATCTGGCCTAGGCATTAGCGCTGCGCCCGCTTCACCGCC
TTCTCGTCCTACAAGTTCCAACCACTCAAATTCTCTACCCCCTCATCCAC
AGGACGACTTTGATGATGATTATACTGATGATCATGCTCAATCTGTCACT
TATGGACGCCTCATCCAAGGCCACATTGTTGATGATGATTATCCATCTCC
TTCCCCCTCGATCATTGCATCTACTACCCATGGCGATACCGATCACATGA
TGTCCTCAATTCACTCTCTTGCTTCATTGCACGGTGACGGGGCCCTTGGT
GGTTCTATCGATGCCAATGACACAGACGAGGAGGAAGATGCTGACCAGAT
TCCGGGAAACGAAAAGATGATAACACTTGTCGGTGAGGTCCGCAGAAAAA
CAGTTCTCATTGTGGATGATATGATTGATCGTGCTGGATCGTGGATCTCT
GCGGCAGAGCATGTTAAACTGAGGGGTGGTGCTAAGAAGGTTATTTGCAT
CGCGACGCATGGTGTATTCGGTGGAAATTGCCTTAAGGAAATGGAGGACT
GCAGTTGTATCGATCAAATAGTCGTCACTAATAGTTTTCCCATTCCGGAG
GACAAGAGGAAAGGGGTTAAAAAGCTTGTCACTATTGATCTGAGC

Sequences in the Contig:

SY0AAA45YE12FM1 SY0AAA45YP17FM1 SY0AAB27YG22FM1
SY0AAC1YP02FM1 SY0AAC56YO14FM1 SY0AAD61YI07FM1